Incidental Mutation 'R1888:Sntb1'
ID 308211
Institutional Source Beutler Lab
Gene Symbol Sntb1
Ensembl Gene ENSMUSG00000060429
Gene Name syntrophin, basic 1
Synonyms beta1-Syntrophin, 59-1 DAP
MMRRC Submission 039909-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R1888 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 55499784-55770345 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 55612745 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 278 (R278*)
Ref Sequence ENSEMBL: ENSMUSP00000041294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039769]
AlphaFold Q99L88
Predicted Effect probably null
Transcript: ENSMUST00000039769
AA Change: R278*
SMART Domains Protein: ENSMUSP00000041294
Gene: ENSMUSG00000060429
AA Change: R278*

DomainStartEndE-ValueType
PH 19 299 5.14e0 SMART
PDZ 120 194 4.5e-17 SMART
PH 322 434 2.81e-8 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dystrophin is a large, rod-like cytoskeletal protein found at the inner surface of muscle fibers. Dystrophin is missing in Duchenne Muscular Dystrophy patients and is present in reduced amounts in Becker Muscular Dystrophy patients. The protein encoded by this gene is a peripheral membrane protein found associated with dystrophin and dystrophin-related proteins. This gene is a member of the syntrophin gene family, which contains at least two other structurally-related genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik A G 12: 72,960,030 (GRCm39) M80T unknown Het
4930578I06Rik A G 14: 64,223,632 (GRCm39) L48P probably damaging Het
Abcc9 A G 6: 142,625,040 (GRCm39) S452P probably benign Het
Adgrb2 T C 4: 129,907,419 (GRCm39) F977S probably damaging Het
Adgrf5 T G 17: 43,737,896 (GRCm39) probably null Het
Adgrl4 A G 3: 151,144,914 (GRCm39) N21S probably benign Het
Adss2 A T 1: 177,612,517 (GRCm39) Y77* probably null Het
Ahnak A T 19: 8,984,452 (GRCm39) D1912V probably damaging Het
Ahnak2 A G 12: 112,740,325 (GRCm39) M1249T possibly damaging Het
Akap6 A T 12: 53,188,958 (GRCm39) D2124V possibly damaging Het
Ankrd28 A T 14: 31,453,982 (GRCm39) probably benign Het
Bbs12 C A 3: 37,374,712 (GRCm39) L387I probably damaging Het
BC023105 T C 18: 60,575,571 (GRCm39) noncoding transcript Het
Ciita T C 16: 10,328,948 (GRCm39) Y411H probably damaging Het
Ckb TCCACCACCA TCCACCA 12: 111,636,079 (GRCm39) probably benign Het
Clec9a G A 6: 129,387,249 (GRCm39) V35I probably benign Het
Cntn5 T A 9: 9,984,082 (GRCm39) Q382L possibly damaging Het
Cracdl T C 1: 37,663,364 (GRCm39) K845E possibly damaging Het
Dock2 A T 11: 34,598,169 (GRCm39) I334N probably damaging Het
Dock9 G T 14: 121,862,617 (GRCm39) T833K probably benign Het
Drd2 G A 9: 49,313,442 (GRCm39) V204I probably benign Het
Fam120a A T 13: 49,039,342 (GRCm39) I938N possibly damaging Het
Fndc1 T C 17: 7,990,621 (GRCm39) E1025G unknown Het
Fsip2 G A 2: 82,774,504 (GRCm39) D64N probably benign Het
Gm14496 T A 2: 181,641,989 (GRCm39) C553* probably null Het
Gm15587 C G 5: 24,572,467 (GRCm39) probably benign Het
Gm6020 C T 19: 61,172,391 (GRCm39) H22Y possibly damaging Het
Gvin3 A T 7: 106,196,630 (GRCm39) noncoding transcript Het
Hexa A G 9: 59,464,586 (GRCm39) T159A probably benign Het
Hmcn1 C G 1: 150,695,251 (GRCm39) A218P possibly damaging Het
Hpgds A G 6: 65,115,217 (GRCm39) F22S probably damaging Het
Il5ra T A 6: 106,708,874 (GRCm39) N289Y probably damaging Het
Ilf2 T C 3: 90,394,767 (GRCm39) probably benign Het
Irf2 A T 8: 47,260,388 (GRCm39) R107* probably null Het
Kcnk6 T C 7: 28,925,075 (GRCm39) I180M probably benign Het
Krtap5-3 G A 7: 141,755,979 (GRCm39) probably benign Het
Lrig1 C T 6: 94,631,859 (GRCm39) A114T probably benign Het
Lrrc37a A G 11: 103,389,587 (GRCm39) V1946A probably benign Het
Lrrc8b T C 5: 105,629,217 (GRCm39) V521A probably benign Het
Macf1 T G 4: 123,348,835 (GRCm39) I2154L possibly damaging Het
Macf1 C A 4: 123,368,505 (GRCm39) E2085D probably benign Het
Maml1 C T 11: 50,157,468 (GRCm39) A236T probably benign Het
Mdc1 C A 17: 36,165,117 (GRCm39) T1481K probably benign Het
Mecp2 C T X: 73,080,781 (GRCm39) A79T probably damaging Homo
Med24 A G 11: 98,598,108 (GRCm39) probably benign Het
Mfap3l T C 8: 61,124,424 (GRCm39) V222A possibly damaging Het
Mis18bp1 A G 12: 65,196,102 (GRCm39) I554T probably benign Het
Mpped2 T C 2: 106,529,790 (GRCm39) I13T probably benign Het
Mthfd1l C A 10: 4,056,528 (GRCm39) T948K probably damaging Het
Mtus1 C T 8: 41,537,362 (GRCm39) S118N probably damaging Het
Mtx3 A G 13: 92,984,191 (GRCm39) E156G probably benign Het
Mybbp1a C T 11: 72,336,863 (GRCm39) T565I probably benign Het
Myh2 G A 11: 67,071,676 (GRCm39) V498M probably damaging Het
Myo15b G A 11: 115,777,899 (GRCm39) G1049S probably damaging Het
Myo1b T A 1: 51,799,562 (GRCm39) probably null Het
Ndufa2 T A 18: 36,877,573 (GRCm39) probably benign Het
Nipal2 T C 15: 34,625,167 (GRCm39) I129M possibly damaging Het
Nt5dc3 A G 10: 86,669,926 (GRCm39) N507S possibly damaging Het
Or4b12 A G 2: 90,095,913 (GRCm39) L287P probably damaging Het
Or8b12b T A 9: 37,684,163 (GRCm39) D69E possibly damaging Het
Pcdhb17 G A 18: 37,620,438 (GRCm39) probably null Het
Pcyt2 A G 11: 120,508,677 (GRCm39) M1T probably null Het
Pear1 C A 3: 87,717,882 (GRCm39) probably benign Het
Pla2g2d T C 4: 138,503,126 (GRCm39) M1T probably null Het
Plekhg6 T C 6: 125,340,306 (GRCm39) T685A probably damaging Het
Pramel19 T A 4: 101,798,335 (GRCm39) V102E probably damaging Het
Pwwp4a G T X: 72,171,261 (GRCm39) G218C probably damaging Homo
Pxk T C 14: 8,151,540 (GRCm38) S452P probably damaging Het
Rab42 A T 4: 132,030,529 (GRCm39) D40E probably benign Het
Rapgef6 A C 11: 54,551,654 (GRCm39) T836P probably damaging Het
Rtn1 A G 12: 72,283,307 (GRCm39) probably benign Het
Serpina3a A G 12: 104,082,362 (GRCm39) D45G probably benign Het
Slco6b1 A G 1: 96,849,786 (GRCm39) noncoding transcript Het
Smad9 CTTT CTT 3: 54,696,600 (GRCm39) probably benign Het
Spice1 T G 16: 44,185,989 (GRCm39) S111A probably damaging Het
Stk40 T A 4: 126,019,538 (GRCm39) L90Q probably damaging Het
Syk A G 13: 52,794,826 (GRCm39) Y520C probably damaging Het
Syngr2 G A 11: 117,704,224 (GRCm39) V170M possibly damaging Het
Tcf12 A T 9: 71,765,816 (GRCm39) D541E possibly damaging Het
Tedc2 T A 17: 24,435,291 (GRCm39) E366V probably damaging Het
Tedc2 C A 17: 24,435,292 (GRCm39) E366* probably null Het
Tlr4 T C 4: 66,759,409 (GRCm39) V734A probably damaging Het
Tmem132a T C 19: 10,840,863 (GRCm39) E389G probably damaging Het
Tmem150b A G 7: 4,712,044 (GRCm39) I112T probably benign Het
Tmod1 C T 4: 46,097,069 (GRCm39) silent Het
Trbc1 G A 6: 41,512,570 (GRCm39) probably benign Het
Tril A G 6: 53,796,577 (GRCm39) L215P probably damaging Het
Trim24 G T 6: 37,934,013 (GRCm39) R652L probably damaging Het
Ttn G A 2: 76,623,151 (GRCm39) P15429S probably damaging Het
Ttn T A 2: 76,706,302 (GRCm39) probably benign Het
Tubgcp2 A G 7: 139,579,183 (GRCm39) V701A probably damaging Het
Tubgcp2 A G 7: 139,586,069 (GRCm39) F407L probably damaging Het
Usp45 T C 4: 21,784,811 (GRCm39) probably benign Het
Vmn1r30 A C 6: 58,412,475 (GRCm39) L119R possibly damaging Het
Washc5 A C 15: 59,231,174 (GRCm39) L363R probably damaging Het
Zan T C 5: 137,387,590 (GRCm39) T4874A unknown Het
Zfp420 A T 7: 29,573,933 (GRCm39) H51L probably damaging Het
Zfp512b C A 2: 181,230,235 (GRCm39) R497L probably damaging Het
Zmat4 A G 8: 24,505,177 (GRCm39) N139S probably damaging Het
Zng1 A T 19: 24,932,769 (GRCm39) V88D probably damaging Het
Other mutations in Sntb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Sntb1 APN 15 55,511,435 (GRCm39) missense possibly damaging 0.93
IGL02732:Sntb1 APN 15 55,655,596 (GRCm39) missense possibly damaging 0.62
IGL02965:Sntb1 APN 15 55,506,081 (GRCm39) nonsense probably null
IGL03084:Sntb1 APN 15 55,655,487 (GRCm39) missense probably damaging 0.99
IGL03286:Sntb1 APN 15 55,655,442 (GRCm39) missense possibly damaging 0.59
R0117:Sntb1 UTSW 15 55,769,749 (GRCm39) missense probably benign
R0178:Sntb1 UTSW 15 55,769,540 (GRCm39) missense probably damaging 0.98
R0465:Sntb1 UTSW 15 55,612,672 (GRCm39) missense probably benign 0.02
R0626:Sntb1 UTSW 15 55,506,179 (GRCm39) missense probably benign 0.20
R0726:Sntb1 UTSW 15 55,539,752 (GRCm39) missense probably benign
R1125:Sntb1 UTSW 15 55,612,676 (GRCm39) missense probably benign
R1443:Sntb1 UTSW 15 55,511,351 (GRCm39) missense probably damaging 1.00
R1888:Sntb1 UTSW 15 55,612,745 (GRCm39) nonsense probably null
R2208:Sntb1 UTSW 15 55,769,714 (GRCm39) missense possibly damaging 0.79
R2426:Sntb1 UTSW 15 55,769,575 (GRCm39) missense probably damaging 1.00
R3721:Sntb1 UTSW 15 55,506,214 (GRCm39) missense probably benign 0.10
R4370:Sntb1 UTSW 15 55,655,487 (GRCm39) missense probably damaging 0.99
R4706:Sntb1 UTSW 15 55,612,670 (GRCm39) missense probably benign 0.09
R4883:Sntb1 UTSW 15 55,506,198 (GRCm39) nonsense probably null
R5223:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5242:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5270:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5313:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5314:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5316:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5336:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5337:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5396:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5398:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5427:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5428:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5429:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5431:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5594:Sntb1 UTSW 15 55,506,191 (GRCm39) missense probably damaging 1.00
R5658:Sntb1 UTSW 15 55,655,472 (GRCm39) missense probably damaging 1.00
R5665:Sntb1 UTSW 15 55,655,535 (GRCm39) missense probably benign 0.00
R6147:Sntb1 UTSW 15 55,511,406 (GRCm39) missense probably benign
R6159:Sntb1 UTSW 15 55,539,698 (GRCm39) critical splice donor site probably null
R6883:Sntb1 UTSW 15 55,769,719 (GRCm39) missense probably benign 0.38
R7008:Sntb1 UTSW 15 55,655,468 (GRCm39) nonsense probably null
R7168:Sntb1 UTSW 15 55,654,661 (GRCm39) missense probably benign 0.00
R7511:Sntb1 UTSW 15 55,511,347 (GRCm39) missense possibly damaging 0.71
R7600:Sntb1 UTSW 15 55,655,584 (GRCm39) missense possibly damaging 0.82
R8242:Sntb1 UTSW 15 55,655,629 (GRCm39) missense possibly damaging 0.95
R8804:Sntb1 UTSW 15 55,655,523 (GRCm39) missense probably benign 0.37
R9280:Sntb1 UTSW 15 55,769,771 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCAATTGACAGGAAGACTTTCTC -3'
(R):5'- TGTGCTCCAAAGGCACAGAC -3'

Sequencing Primer
(F):5'- CTTACCTTTTCTGCAAGCCAG -3'
(R):5'- AGCCTGGGCAACTGATGATTG -3'
Posted On 2015-04-17