Incidental Mutation 'R3925:Prim2'
ID308228
Institutional Source Beutler Lab
Gene Symbol Prim2
Ensembl Gene ENSMUSG00000026134
Gene NameDNA primase, p58 subunit
Synonyms
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R3925 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location33453810-33669795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33533299 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 253 (L253P)
Ref Sequence ENSEMBL: ENSMUSP00000027312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027312]
Predicted Effect probably damaging
Transcript: ENSMUST00000027312
AA Change: L253P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027312
Gene: ENSMUSG00000026134
AA Change: L253P

DomainStartEndE-ValueType
Pfam:DNA_primase_lrg 182 448 6.2e-99 PFAM
low complexity region 482 503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189552
Meta Mutation Damage Score 0.0328 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 58 kilodalton subunit of DNA primase, an enzyme that plays a key role in the replication of DNA. The encoded protein forms a heterodimer with a 49 kilodalton subunit. This heterodimer functions as a DNA-directed RNA polymerase to synthesize small RNA primers that are used to create Okazaki fragments on the lagging strand of the DNA. Alternative splicing of this gene results in multiple transcript variants. This gene has a related pseudogene, which is also present on chromosome 6. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Prim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Prim2 APN 1 33512160 missense probably damaging 1.00
IGL02576:Prim2 APN 1 33484717 missense probably damaging 1.00
R0398:Prim2 UTSW 1 33484676 splice site probably benign
R0686:Prim2 UTSW 1 33514189 missense probably benign
R1452:Prim2 UTSW 1 33630404 missense probably benign
R4398:Prim2 UTSW 1 33512111 missense probably damaging 1.00
R4831:Prim2 UTSW 1 33670136 unclassified probably benign
R4832:Prim2 UTSW 1 33464064 missense probably benign
R5057:Prim2 UTSW 1 33630360 nonsense probably null
R5240:Prim2 UTSW 1 33480316 intron probably benign
R5294:Prim2 UTSW 1 33668893 missense probably benign 0.11
R5771:Prim2 UTSW 1 33454151 missense unknown
R5807:Prim2 UTSW 1 33480406 intron probably benign
R6307:Prim2 UTSW 1 33662292 missense probably benign 0.00
R7165:Prim2 UTSW 1 33628393 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TACCTGAGATCAAATAGTCAGGAG -3'
(R):5'- ATTTGTGCATGGCCTCCCTG -3'

Sequencing Primer
(F):5'- ACATAGATATACATATGCACTGTGTG -3'
(R):5'- GGCTGCCTCCCCTCCTTAG -3'
Posted On2015-04-17