Incidental Mutation 'R3925:Pabpc1l'
ID308233
Institutional Source Beutler Lab
Gene Symbol Pabpc1l
Ensembl Gene ENSMUSG00000054582
Gene Namepoly(A) binding protein, cytoplasmic 1-like
Synonyms1810053B01Rik, ePAB
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3925 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164025450-164050538 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 164027676 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067715]
Predicted Effect probably benign
Transcript: ENSMUST00000067715
SMART Domains Protein: ENSMUSP00000096701
Gene: ENSMUSG00000054582

DomainStartEndE-ValueType
RRM 12 85 2.3e-23 SMART
RRM 100 171 1.84e-22 SMART
RRM 192 264 2.31e-28 SMART
RRM 295 366 7.07e-24 SMART
SCOP:d1g9la_ 425 478 1e-6 SMART
PolyA 535 598 8.33e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141671
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired oocyte maturation and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Pabpc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Pabpc1l APN 2 164042317 missense probably damaging 1.00
IGL00911:Pabpc1l APN 2 164042423 missense probably damaging 1.00
IGL02096:Pabpc1l APN 2 164044347 missense probably benign 0.00
IGL02198:Pabpc1l APN 2 164027616 missense probably damaging 0.97
IGL02534:Pabpc1l APN 2 164027490 missense probably damaging 1.00
IGL02684:Pabpc1l APN 2 164031277 missense probably benign
R0371:Pabpc1l UTSW 2 164035272 missense probably benign 0.08
R0799:Pabpc1l UTSW 2 164031214 missense probably benign
R1202:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1203:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1548:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1549:Pabpc1l UTSW 2 164037171 missense possibly damaging 0.74
R1687:Pabpc1l UTSW 2 164044306 missense probably benign 0.00
R1928:Pabpc1l UTSW 2 164032254 missense possibly damaging 0.70
R2698:Pabpc1l UTSW 2 164044382 critical splice donor site probably null
R3944:Pabpc1l UTSW 2 164042327 missense probably damaging 1.00
R4052:Pabpc1l UTSW 2 164043613 missense probably benign 0.20
R4793:Pabpc1l UTSW 2 164027622 missense possibly damaging 0.94
R5001:Pabpc1l UTSW 2 164042518 missense probably benign 0.00
R5104:Pabpc1l UTSW 2 164043587 missense probably benign 0.00
R5456:Pabpc1l UTSW 2 164027660 missense probably damaging 1.00
R5569:Pabpc1l UTSW 2 164043554 missense probably benign 0.00
R5853:Pabpc1l UTSW 2 164049518 missense probably benign 0.00
R5857:Pabpc1l UTSW 2 164044255 splice site probably null
R7107:Pabpc1l UTSW 2 164042479 missense probably damaging 0.99
R7650:Pabpc1l UTSW 2 164049590 missense probably benign 0.28
T0722:Pabpc1l UTSW 2 164042420 missense possibly damaging 0.89
Z1088:Pabpc1l UTSW 2 164032324 splice site probably null
Predicted Primers PCR Primer
(F):5'- AATGTCACCTAACTTGCCCC -3'
(R):5'- AGATTACACACCGAGATCGAGC -3'

Sequencing Primer
(F):5'- CGGGCACTAGACACAATGAACTTTG -3'
(R):5'- TTACACACCGAGATCGAGCTGTTG -3'
Posted On2015-04-17