Incidental Mutation 'R3925:Crct1'
ID308235
Institutional Source Beutler Lab
Gene Symbol Crct1
Ensembl Gene ENSMUSG00000027913
Gene Namecysteine-rich C-terminal 1
SynonymsNice-1, 2300002G24Rik
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R3925 (G1)
Quality Score194
Status Validated
Chromosome3
Chromosomal Location93014205-93015687 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 93014707 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029520] [ENSMUST00000029521] [ENSMUST00000107301] [ENSMUST00000193944]
Predicted Effect probably benign
Transcript: ENSMUST00000029520
SMART Domains Protein: ENSMUSP00000029520
Gene: ENSMUSG00000027912

DomainStartEndE-ValueType
Pfam:LCE 9 96 5.4e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000029521
AA Change: R41M
SMART Domains Protein: ENSMUSP00000029521
Gene: ENSMUSG00000027913
AA Change: R41M

DomainStartEndE-ValueType
low complexity region 12 102 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107301
AA Change: R41M
SMART Domains Protein: ENSMUSP00000102922
Gene: ENSMUSG00000027913
AA Change: R41M

DomainStartEndE-ValueType
Pfam:NICE-1 5 100 5.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193944
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Crct1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3706:Crct1 UTSW 3 93014707 unclassified probably benign
R3745:Crct1 UTSW 3 93014707 unclassified probably benign
R3805:Crct1 UTSW 3 93014707 unclassified probably benign
R3926:Crct1 UTSW 3 93014707 unclassified probably benign
R4757:Crct1 UTSW 3 93014786 nonsense probably null
R4921:Crct1 UTSW 3 93014825 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTGAACTCTGATTGTTGC -3'
(R):5'- GCCAGACAGACTTTTCTCTAAGG -3'

Sequencing Primer
(F):5'- AACTCTGATTGTTGCAGGAGC -3'
(R):5'- AAGTTCTGTGTTCCACTATAGGGAAG -3'
Posted On2015-04-17