Mutagenetix > Incidental Mutation

Incidental Mutation 'R3925:Eif4e'

308236

Institutional Source

Beutler Lab

Gene Symbol

Eif4e

Ensembl Gene

ENSMUSG00000028156

Gene Name

eukaryotic translation initiation factor 4E

Synonyms

If4e, eIF-4E

MMRRC Submission

040916-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R3925 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

138231952-138265457 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 138261198 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 164 (G164D)

Ref Sequence

ENSEMBL: ENSMUSP00000143772 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029803] [ENSMUST00000196990] [ENSMUST00000200020] [ENSMUST00000200100] [ENSMUST00000200239]

AlphaFold

P63073

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029803
AA Change: G196D

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029803
Gene: ENSMUSG00000028156
AA Change: G196D

Domain	Start	End	E-Value	Type
low complexity region	3	23	N/A	INTRINSIC
Pfam:IF4E	38	199	8.7e-60	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000196990
AA Change: G111D

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000143104
Gene: ENSMUSG00000028156
AA Change: G111D

Domain	Start	End	E-Value	Type
Pfam:IF4E	1	115	1.4e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198252

Predicted Effect

probably benign
Transcript: ENSMUST00000200020

SMART Domains

Protein: ENSMUSP00000143690
Gene: ENSMUSG00000028156

Domain	Start	End	E-Value	Type
low complexity region	3	23	N/A	INTRINSIC
Pfam:IF4E	38	183	1.9e-53	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000200100
AA Change: G164D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000143772
Gene: ENSMUSG00000028156
AA Change: G164D

Domain	Start	End	E-Value	Type
low complexity region	3	23	N/A	INTRINSIC
Pfam:IF4E	31	167	3.2e-40	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200239

SMART Domains

Protein: ENSMUSP00000143481
Gene: ENSMUSG00000028156

Domain	Start	End	E-Value	Type
low complexity region	3	23	N/A	INTRINSIC
Pfam:IF4E	38	79	5.4e-9	PFAM

Meta Mutation Damage Score

0.1515

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: This gene encodes a component of the eukaryotic translation initiation factor 4F complex, which recognizes the 7-methylguanosine cap structure at the 5' end of messenger RNAs. The encoded protein aids in translation initiation by recruiting ribosomes to the 5'-cap structure. Association of this protein with the 4F complex is the rate-limiting step in translation initiation. This gene acts as a proto-oncogene, and its expression and activation is associated with transformation and tumorigenesis. It has also been associated with autism spectrum disorders. Consistently, knockout of this gene results in increased translation of neuroligins, postsynaptic proteins linked to autism spectrum disorders. Pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit resistance to developing prostate intraepithelial neoplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	G	A	13: 81,726,891 (GRCm39)	T487I	possibly damaging	Het
Amn	T	C	12: 111,242,114 (GRCm39)	V367A	possibly damaging	Het
Becn2	T	C	1: 175,748,852 (GRCm39)	V306A	probably benign	Het
C230029F24Rik	AGAAAG	A	1: 49,350,088 (GRCm39)		noncoding transcript	Het
Cdkl1	G	T	12: 69,803,373 (GRCm39)	R168S	probably damaging	Het
Cfap43	T	C	19: 47,785,555 (GRCm39)	K445R	probably benign	Het
Crct1	C	A	3: 92,922,014 (GRCm39)		probably benign	Het
Eno1	T	C	4: 150,324,025 (GRCm39)		probably null	Het
Hmcn2	G	A	2: 31,343,169 (GRCm39)	R4565Q	probably benign	Het
Itgal	A	T	7: 126,923,709 (GRCm39)		probably benign	Het
Klhl1	A	T	14: 96,584,316 (GRCm39)	C305S	possibly damaging	Het
Ms4a2	A	G	19: 11,596,312 (GRCm39)	M139T	probably benign	Het
Nr2e3	C	T	9: 59,855,716 (GRCm39)	R213H	probably damaging	Het
Onecut2	A	G	18: 64,474,591 (GRCm39)	K381E	probably damaging	Het
Or2t43	T	A	11: 58,457,652 (GRCm39)	H173L	probably benign	Het
Or52n1	T	A	7: 104,383,396 (GRCm39)	E58D	probably benign	Het
Or5t17	A	G	2: 86,832,718 (GRCm39)	Y135C	possibly damaging	Het
Pabpc1l	T	A	2: 163,869,596 (GRCm39)		probably benign	Het
Prim2	A	G	1: 33,572,380 (GRCm39)	L253P	probably damaging	Het
Pycr1	T	C	11: 120,532,961 (GRCm39)	T100A	probably benign	Het
Qrfpr	T	C	3: 36,276,072 (GRCm39)	N106S	possibly damaging	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,229,114 (GRCm39)		probably benign	Het
Selenoi	T	A	5: 30,461,086 (GRCm39)	D107E	probably damaging	Het
Synrg	C	T	11: 83,931,725 (GRCm39)	P1321S	probably benign	Het
Trgv7	A	G	13: 19,362,644 (GRCm39)	Y111C	probably damaging	Het
Trp53rkb	A	G	2: 166,637,392 (GRCm39)	Y116C	probably damaging	Het
Usp34	T	A	11: 23,293,640 (GRCm39)	F245I	probably benign	Het
Utrn	C	T	10: 12,573,786 (GRCm39)	V1095I	probably benign	Het
Xpnpep1	T	C	19: 52,980,128 (GRCm39)	H632R	probably damaging	Het
Zfp735	T	C	11: 73,601,950 (GRCm39)	I298T	probably benign	Het
Zfp953	T	A	13: 67,496,002 (GRCm39)	Y13F	probably damaging	Het

Other mutations in Eif4e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Eif4e	APN	3	138,253,412 (GRCm39)	splice site	probably benign
IGL03328:Eif4e	APN	3	138,259,488 (GRCm39)	intron	probably benign
R1398:Eif4e	UTSW	3	138,252,136 (GRCm39)	missense	probably damaging	0.99
R2010:Eif4e	UTSW	3	138,261,219 (GRCm39)	missense	probably benign	0.08
R6026:Eif4e	UTSW	3	138,256,661 (GRCm39)	missense	probably damaging	1.00
R7038:Eif4e	UTSW	3	138,232,943 (GRCm39)	unclassified	probably benign
R8916:Eif4e	UTSW	3	138,256,043 (GRCm39)	intron	probably benign
R9111:Eif4e	UTSW	3	138,252,122 (GRCm39)	missense	probably benign	0.00
R9350:Eif4e	UTSW	3	138,259,470 (GRCm39)	missense	probably benign	0.01
R9414:Eif4e	UTSW	3	138,253,495 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTCTGGCTGTGAAAGTAAAGAC -3'
(R):5'- GGATGGAATCAACTTCAGTGC -3'

Sequencing Primer
(F):5'- CGACTTGCATTGCTAATGTA -3'
(R):5'- GATGGAATCAACTTCAGTGCAGTCC -3'

Posted On

2015-04-17