Incidental Mutation 'R0377:Trps1'
ID30824
Institutional Source Beutler Lab
Gene Symbol Trps1
Ensembl Gene ENSMUSG00000038679
Gene Nametranscriptional repressor GATA binding 1
SynonymsD15Ertd586e
MMRRC Submission 038583-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0377 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location50654752-50890463 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 50831778 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 324 (E324*)
Ref Sequence ENSEMBL: ENSMUSP00000138905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077935] [ENSMUST00000165201] [ENSMUST00000183421] [ENSMUST00000183757] [ENSMUST00000183997] [ENSMUST00000184458] [ENSMUST00000184885]
Predicted Effect probably null
Transcript: ENSMUST00000077935
AA Change: E370*
SMART Domains Protein: ENSMUSP00000077089
Gene: ENSMUSG00000038679
AA Change: E370*

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165201
AA Change: E370*
SMART Domains Protein: ENSMUSP00000129779
Gene: ENSMUSG00000038679
AA Change: E370*

DomainStartEndE-ValueType
ZnF_C2H2 222 247 1.41e0 SMART
ZnF_C2H2 333 358 4.45e0 SMART
ZnF_C2H2 434 459 1.31e2 SMART
ZnF_C2H2 523 554 1.93e2 SMART
low complexity region 597 602 N/A INTRINSIC
ZnF_C2H2 614 637 8.67e-1 SMART
ZnF_C2H2 666 689 2.29e0 SMART
ZnF_C2H2 692 715 8.22e-2 SMART
low complexity region 766 779 N/A INTRINSIC
ZnF_GATA 890 940 3.95e-16 SMART
low complexity region 1050 1062 N/A INTRINSIC
ZnF_C2H2 1215 1237 4.34e0 SMART
ZnF_C2H2 1243 1267 5.72e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183421
SMART Domains Protein: ENSMUSP00000138835
Gene: ENSMUSG00000038679

DomainStartEndE-ValueType
ZnF_C2H2 26 49 8.22e-2 SMART
low complexity region 100 113 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183757
AA Change: E374*
SMART Domains Protein: ENSMUSP00000139017
Gene: ENSMUSG00000038679
AA Change: E374*

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 438 463 1.31e2 SMART
ZnF_C2H2 527 558 1.93e2 SMART
low complexity region 601 606 N/A INTRINSIC
ZnF_C2H2 618 641 8.67e-1 SMART
ZnF_C2H2 670 693 2.29e0 SMART
ZnF_C2H2 696 719 8.22e-2 SMART
low complexity region 770 783 N/A INTRINSIC
ZnF_GATA 894 944 3.95e-16 SMART
low complexity region 1054 1066 N/A INTRINSIC
ZnF_C2H2 1219 1241 4.34e0 SMART
ZnF_C2H2 1247 1271 5.72e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183997
AA Change: E374*
SMART Domains Protein: ENSMUSP00000139115
Gene: ENSMUSG00000038679
AA Change: E374*

DomainStartEndE-ValueType
ZnF_C2H2 226 251 1.41e0 SMART
ZnF_C2H2 337 362 4.45e0 SMART
ZnF_C2H2 470 493 2.29e0 SMART
ZnF_C2H2 496 519 8.22e-2 SMART
low complexity region 570 583 N/A INTRINSIC
ZnF_GATA 705 755 3.95e-16 SMART
low complexity region 865 877 N/A INTRINSIC
ZnF_C2H2 1030 1052 4.34e0 SMART
ZnF_C2H2 1058 1082 5.72e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184458
AA Change: E83*
SMART Domains Protein: ENSMUSP00000139063
Gene: ENSMUSG00000038679
AA Change: E83*

DomainStartEndE-ValueType
ZnF_C2H2 46 71 4.45e0 SMART
ZnF_C2H2 147 172 1.31e2 SMART
ZnF_C2H2 236 267 1.93e2 SMART
low complexity region 310 315 N/A INTRINSIC
ZnF_C2H2 327 350 8.67e-1 SMART
ZnF_C2H2 379 402 2.29e0 SMART
ZnF_C2H2 405 428 8.22e-2 SMART
low complexity region 479 492 N/A INTRINSIC
ZnF_GATA 603 653 3.95e-16 SMART
low complexity region 763 775 N/A INTRINSIC
ZnF_C2H2 928 950 4.34e0 SMART
ZnF_C2H2 956 980 5.72e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184885
AA Change: E324*
SMART Domains Protein: ENSMUSP00000138905
Gene: ENSMUSG00000038679
AA Change: E324*

DomainStartEndE-ValueType
ZnF_C2H2 176 201 1.41e0 SMART
ZnF_C2H2 287 312 4.45e0 SMART
ZnF_C2H2 420 443 2.29e0 SMART
ZnF_C2H2 446 469 8.22e-2 SMART
low complexity region 520 533 N/A INTRINSIC
ZnF_GATA 644 694 3.95e-16 SMART
low complexity region 804 816 N/A INTRINSIC
ZnF_C2H2 969 991 4.34e0 SMART
ZnF_C2H2 997 1021 5.72e-1 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that represses GATA-regulated genes and binds to a dynein light chain protein. Binding of the encoded protein to the dynein light chain protein affects binding to GATA consensus sequences and suppresses its transcriptional activity. Defects in this gene are a cause of tricho-rhino-phalangeal syndrome (TRPS) types I-III. [provided by RefSeq, Jul 2008]
PHENOTYPE: Newborn mice homozygous for a knock-out allele exhibit craniofacial and hair anomalies and die of respiratory failure due to thoracic spine and rib defects. Mice homozygous for a reporter allele show additional defects in chondrocyte proliferation and apoptosis as well as reduced nephron formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C A 11: 94,375,096 V107F possibly damaging Het
Acad11 T A 9: 104,081,692 probably benign Het
Ache G A 5: 137,290,928 E299K possibly damaging Het
Adam5 T C 8: 24,747,541 T618A probably benign Het
Amigo2 T A 15: 97,246,380 T54S possibly damaging Het
Anapc1 A G 2: 128,641,340 probably null Het
Armc4 G A 18: 7,127,415 R933C probably benign Het
Btaf1 A G 19: 36,989,002 K1057E probably benign Het
Cep55 T A 19: 38,071,889 L396* probably null Het
Cic C A 7: 25,285,799 H1157N probably damaging Het
Cntnap5a A T 1: 116,292,529 T690S probably benign Het
D5Ertd579e A T 5: 36,604,567 C1319S probably benign Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Dntt G A 19: 41,047,627 W369* probably null Het
Esp18 T A 17: 39,409,944 W27R probably benign Het
Fam227b A T 2: 126,125,000 probably benign Het
Fbxo31 G A 8: 121,559,102 probably benign Het
Gm13547 G A 2: 29,761,791 probably null Het
Gnl2 T A 4: 125,046,382 probably benign Het
Gpx2 G A 12: 76,795,156 Q74* probably null Het
Gucy2c A G 6: 136,750,917 probably null Het
Hoxa5 A T 6: 52,202,646 W250R probably damaging Het
Izumo4 G A 10: 80,702,840 R42H probably damaging Het
Kcnj12 G A 11: 61,069,396 M71I probably benign Het
Kmt2b A T 7: 30,574,193 L2333Q probably damaging Het
Mak T C 13: 41,049,348 E177G probably damaging Het
Map3k7 T A 4: 31,985,731 I218N probably damaging Het
Mark3 T C 12: 111,629,029 L393P probably damaging Het
Msh4 A G 3: 153,896,890 S234P probably benign Het
Mug1 A G 6: 121,857,361 D367G probably benign Het
Mypn A G 10: 63,127,622 probably benign Het
Ncapg T C 5: 45,693,817 V784A probably benign Het
Nutf2 T A 8: 105,878,872 V113D probably damaging Het
Olfr1080 A T 2: 86,553,583 D180E probably damaging Het
Opn3 T C 1: 175,663,694 M258V probably damaging Het
Osbpl7 A G 11: 97,055,934 D211G probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plekhd1 G A 12: 80,706,436 probably benign Het
Pnpla6 A G 8: 3,541,501 E1165G probably damaging Het
Prkab2 T A 3: 97,662,317 D66E probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptpn23 A T 9: 110,388,132 S885R possibly damaging Het
Rab26 A T 17: 24,530,045 probably benign Het
Rab5a G A 17: 53,500,462 M175I probably benign Het
Rassf9 T A 10: 102,545,649 D297E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Rtp1 A G 16: 23,431,284 Y133C probably damaging Het
Sdr16c5 G A 4: 4,005,546 L263F probably benign Het
Sec14l1 T G 11: 117,149,140 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca1 T C 4: 34,044,267 probably null Het
Stk36 C T 1: 74,612,730 P394L probably benign Het
Stk4 T C 2: 164,096,800 I196T probably damaging Het
Sult1b1 A T 5: 87,517,376 M233K probably damaging Het
Tmem8b C T 4: 43,674,005 T212M probably damaging Het
Tmprss11g A T 5: 86,490,751 F293I probably damaging Het
Tnfsf11 T G 14: 78,299,912 T104P probably benign Het
Trmt2a G A 16: 18,249,703 R80Q possibly damaging Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Wdr18 G A 10: 79,967,502 R400H probably benign Het
Wdr78 A G 4: 103,048,259 V775A probably damaging Het
Zfp119b T A 17: 55,938,671 H505L probably damaging Het
Zfp619 T A 7: 39,536,797 C750* probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Trps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Trps1 APN 15 50846870 missense probably benign 0.07
IGL00497:Trps1 APN 15 50661307 missense possibly damaging 0.91
IGL00558:Trps1 APN 15 50661085 missense probably damaging 1.00
IGL01325:Trps1 APN 15 50846814 missense probably benign 0.40
IGL02132:Trps1 APN 15 50822278 missense probably damaging 1.00
IGL02631:Trps1 APN 15 50846021 missense probably damaging 1.00
IGL02740:Trps1 APN 15 50846539 missense probably damaging 1.00
IGL02821:Trps1 APN 15 50660877 missense probably damaging 1.00
IGL03096:Trps1 APN 15 50846479 missense probably benign
F5770:Trps1 UTSW 15 50831577 missense probably damaging 1.00
R0050:Trps1 UTSW 15 50765525 missense probably benign 0.18
R0244:Trps1 UTSW 15 50664743 missense probably damaging 1.00
R0599:Trps1 UTSW 15 50831860 nonsense probably null
R0848:Trps1 UTSW 15 50661549 missense possibly damaging 0.54
R1744:Trps1 UTSW 15 50661213 missense probably damaging 1.00
R1830:Trps1 UTSW 15 50661136 missense probably damaging 0.99
R2083:Trps1 UTSW 15 50822305 missense probably damaging 1.00
R2167:Trps1 UTSW 15 50831730 missense possibly damaging 0.94
R2267:Trps1 UTSW 15 50822398 missense probably damaging 1.00
R2314:Trps1 UTSW 15 50661346 missense probably damaging 1.00
R3735:Trps1 UTSW 15 50846060 missense possibly damaging 0.94
R4133:Trps1 UTSW 15 50831387 missense probably damaging 1.00
R4223:Trps1 UTSW 15 50846648 missense probably benign
R4280:Trps1 UTSW 15 50846082 missense probably benign 0.00
R4566:Trps1 UTSW 15 50831678 missense probably damaging 1.00
R4810:Trps1 UTSW 15 50822296 missense probably benign 0.14
R4828:Trps1 UTSW 15 50660677 makesense probably null
R4838:Trps1 UTSW 15 50827316 missense probably benign 0.05
R4852:Trps1 UTSW 15 50846309 missense probably damaging 1.00
R5001:Trps1 UTSW 15 50661307 missense possibly damaging 0.91
R5311:Trps1 UTSW 15 50664760 missense probably damaging 1.00
R5463:Trps1 UTSW 15 50831890 nonsense probably null
R5677:Trps1 UTSW 15 50846108 missense probably damaging 1.00
R5691:Trps1 UTSW 15 50827304 missense probably benign
R6432:Trps1 UTSW 15 50831397 missense probably damaging 0.96
R6528:Trps1 UTSW 15 50822427 missense probably benign 0.01
R6594:Trps1 UTSW 15 50830955 missense probably damaging 0.99
R6827:Trps1 UTSW 15 50822563 missense probably benign 0.14
R6862:Trps1 UTSW 15 50831605 critical splice donor site probably null
R6912:Trps1 UTSW 15 50822298 missense possibly damaging 0.92
R7151:Trps1 UTSW 15 50822397 missense possibly damaging 0.95
R7846:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7857:Trps1 UTSW 15 50661005 missense probably damaging 1.00
R7929:Trps1 UTSW 15 50831877 missense probably damaging 0.99
R7940:Trps1 UTSW 15 50661005 missense probably damaging 1.00
V7580:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7581:Trps1 UTSW 15 50831577 missense probably damaging 1.00
V7583:Trps1 UTSW 15 50831577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTAAGGGAGCTGGATGACTCAC -3'
(R):5'- GGAACTTTCATTGGCATTGGACGG -3'

Sequencing Primer
(F):5'- CCAGTAATAACTGGTGGCCTCTG -3'
(R):5'- TTCATTGGCATTGGACGGAAAAC -3'
Posted On2013-04-24