Incidental Mutation 'R3925:Nr2e3'
ID308243
Institutional Source Beutler Lab
Gene Symbol Nr2e3
Ensembl Gene ENSMUSG00000032292
Gene Namenuclear receptor subfamily 2, group E, member 3
SynonymsRNR, photoreceptor-specific nuclear receptor, Pnr
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3925 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location59942771-59960659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59948433 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 213 (R213H)
Ref Sequence ENSEMBL: ENSMUSP00000034831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034831]
Predicted Effect probably damaging
Transcript: ENSMUST00000034831
AA Change: R213H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034831
Gene: ENSMUSG00000032292
AA Change: R213H

DomainStartEndE-ValueType
ZnF_C4 37 109 1.26e-32 SMART
HOLI 209 367 3.92e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156845
Meta Mutation Damage Score 0.0336 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is part of a large family of nuclear receptor transcription factors involved in signaling pathways. Nuclear receptors have been shown to regulate pathways involved in embryonic development, as well as in maintenance of proper cell function in adults. Members of this family are characterized by discrete domains that function in DNA and ligand binding. This gene encodes a retinal nuclear receptor that is a ligand-dependent transcription factor. Defects in this gene are a cause of enhanced S cone syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation exhibit rossettes and a reduced number of nuclei in the retinal outer nuclear layer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Nr2e3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Nr2e3 APN 9 59949008 missense probably benign 0.14
R1448:Nr2e3 UTSW 9 59943514 missense probably damaging 1.00
R1521:Nr2e3 UTSW 9 59949205 missense probably damaging 0.99
R1657:Nr2e3 UTSW 9 59948767 missense probably benign 0.08
R1819:Nr2e3 UTSW 9 59943437 missense probably damaging 1.00
R1953:Nr2e3 UTSW 9 59949796 missense probably benign 0.23
R3919:Nr2e3 UTSW 9 59943440 missense probably damaging 1.00
R4654:Nr2e3 UTSW 9 59949072 intron probably benign
R5239:Nr2e3 UTSW 9 59949776 splice site probably benign
R5310:Nr2e3 UTSW 9 59949334 intron probably benign
R5586:Nr2e3 UTSW 9 59949201 missense probably damaging 0.99
R5811:Nr2e3 UTSW 9 59943418 small deletion probably benign
R5812:Nr2e3 UTSW 9 59943418 small deletion probably benign
R5813:Nr2e3 UTSW 9 59943418 small deletion probably benign
R7267:Nr2e3 UTSW 9 59948689 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AAACTATGTAAGTCTCCATCCCTCG -3'
(R):5'- TTATGGCCAGCCTTATCACCG -3'

Sequencing Primer
(F):5'- ATCCCTCGCCAGCCCAG -3'
(R):5'- ACTTGTGCTAAACTGGAGCC -3'
Posted On2015-04-17