Incidental Mutation 'R3925:Olfr224'
ID308247
Institutional Source Beutler Lab
Gene Symbol Olfr224
Ensembl Gene ENSMUSG00000059279
Gene Nameolfactory receptor 224
SynonymsGA_x6K02T2NKPP-858022-858862, Olfr327-ps1, MOR275-10_p, GA_x6K02T00261-652-347, MOR275-3
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R3925 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58565856-58570553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58566826 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 173 (H173L)
Ref Sequence ENSEMBL: ENSMUSP00000150268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081102] [ENSMUST00000108822] [ENSMUST00000215322] [ENSMUST00000216758] [ENSMUST00000217009]
Predicted Effect probably benign
Transcript: ENSMUST00000081102
AA Change: H173L

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079881
Gene: ENSMUSG00000059279
AA Change: H173L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 299 5.1e-7 PFAM
Pfam:7tm_1 39 288 4.4e-35 PFAM
Pfam:7tm_4 137 281 5.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108822
AA Change: H173L

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104450
Gene: ENSMUSG00000064252
AA Change: H173L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.1e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 299 5.1e-7 PFAM
Pfam:7tm_1 39 288 4.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215322
AA Change: H173L

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216758
AA Change: H173L

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000217009
AA Change: H173L

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Olfr224
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Olfr224 APN 11 58566767 missense probably damaging 1.00
IGL02327:Olfr224 APN 11 58566935 missense probably damaging 1.00
IGL02904:Olfr224 APN 11 58566797 missense possibly damaging 0.61
IGL02968:Olfr224 APN 11 58567195 missense possibly damaging 0.90
R1704:Olfr224 UTSW 11 58566754 missense probably damaging 0.97
R2055:Olfr224 UTSW 11 58566847 missense probably damaging 0.99
R4093:Olfr224 UTSW 11 58566829 missense probably damaging 1.00
R4902:Olfr224 UTSW 11 58566625 missense possibly damaging 0.60
R4955:Olfr224 UTSW 11 58566518 missense probably damaging 1.00
R4956:Olfr224 UTSW 11 58566518 missense probably damaging 1.00
R4957:Olfr224 UTSW 11 58566518 missense probably damaging 1.00
R5436:Olfr224 UTSW 11 58566937 missense probably benign 0.34
R6699:Olfr224 UTSW 11 58567205 missense possibly damaging 0.69
R6825:Olfr224 UTSW 11 58566650 missense possibly damaging 0.89
R7467:Olfr224 UTSW 11 58566462 missense possibly damaging 0.82
R7590:Olfr224 UTSW 11 58567259 missense probably benign 0.09
R7600:Olfr224 UTSW 11 58567336 missense probably benign 0.17
R7725:Olfr224 UTSW 11 58566767 missense probably damaging 1.00
R8438:Olfr224 UTSW 11 58566839 missense possibly damaging 0.74
X0026:Olfr224 UTSW 11 58567174 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CTGCTGAGTTCATCCTGAGAAC -3'
(R):5'- CCTGTGGGATGCAGATGTTC -3'

Sequencing Primer
(F):5'- CTGAGTTCATCCTGAGAACAGTGAG -3'
(R):5'- ATACATGTCACTAGGAGGTTCAG -3'
Posted On2015-04-17