Incidental Mutation 'R3925:Klhl1'
ID308255
Institutional Source Beutler Lab
Gene Symbol Klhl1
Ensembl Gene ENSMUSG00000022076
Gene Namekelch-like 1
Synonyms
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R3925 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location96102736-96519102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 96346880 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 305 (C305S)
Ref Sequence ENSEMBL: ENSMUSP00000022666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022666]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022666
AA Change: C305S

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022666
Gene: ENSMUSG00000022076
AA Change: C305S

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
BTB 215 312 1.13e-28 SMART
BACK 317 418 5.03e-34 SMART
Kelch 463 509 8.86e-10 SMART
Kelch 510 556 1.04e-15 SMART
Kelch 557 603 6.76e-15 SMART
Kelch 604 650 2.23e-15 SMART
Kelch 651 703 3.09e-9 SMART
Kelch 704 750 3.43e-16 SMART
Meta Mutation Damage Score 0.3379 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The KLHL1 protein belongs to a family of actin-organizing proteins related to Drosophila Kelch (Nemes et al., 2000 [PubMed 10888605]).[supplied by OMIM, Feb 2010]
PHENOTYPE: Mice both homozygous and heterozygous for disruption of this gene develop abnormalities in gait and defects in motor coordination with time. Dendritic atrophy of Purkinje cells is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Klhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01573:Klhl1 APN 14 96201204 splice site probably benign
IGL02055:Klhl1 APN 14 96280103 missense possibly damaging 0.96
IGL02110:Klhl1 APN 14 96136603 missense probably benign 0.27
IGL02216:Klhl1 APN 14 96123222 missense probably benign 0.08
IGL02307:Klhl1 APN 14 96201373 missense possibly damaging 0.68
IGL02538:Klhl1 APN 14 96240213 missense probably benign 0.03
IGL02559:Klhl1 APN 14 96151960 missense possibly damaging 0.95
IGL02682:Klhl1 APN 14 96201342 missense possibly damaging 0.83
IGL03228:Klhl1 APN 14 96240327 missense probably damaging 1.00
LCD18:Klhl1 UTSW 14 96317730 intron probably benign
P0041:Klhl1 UTSW 14 96280211 missense probably damaging 1.00
R0270:Klhl1 UTSW 14 96518344 start gained probably benign
R0419:Klhl1 UTSW 14 96381789 missense probably benign 0.30
R0938:Klhl1 UTSW 14 96152040 nonsense probably null
R1465:Klhl1 UTSW 14 96240213 missense probably benign 0.03
R1465:Klhl1 UTSW 14 96240213 missense probably benign 0.03
R1590:Klhl1 UTSW 14 96368636 missense probably damaging 1.00
R1597:Klhl1 UTSW 14 96201211 critical splice donor site probably null
R1893:Klhl1 UTSW 14 96240206 critical splice donor site probably null
R1928:Klhl1 UTSW 14 96346789 missense probably benign 0.02
R2272:Klhl1 UTSW 14 96517908 missense probably benign 0.00
R3612:Klhl1 UTSW 14 96381770 critical splice donor site probably null
R3852:Klhl1 UTSW 14 96280205 missense probably benign 0.12
R3872:Klhl1 UTSW 14 96518179 missense probably benign 0.03
R3874:Klhl1 UTSW 14 96518179 missense probably benign 0.03
R3923:Klhl1 UTSW 14 96346880 missense possibly damaging 0.46
R3926:Klhl1 UTSW 14 96346880 missense possibly damaging 0.46
R4151:Klhl1 UTSW 14 96518316 start codon destroyed probably null 0.73
R4502:Klhl1 UTSW 14 96517846 missense probably benign
R4536:Klhl1 UTSW 14 96136583 critical splice donor site probably null
R4729:Klhl1 UTSW 14 96280148 missense probably damaging 1.00
R4756:Klhl1 UTSW 14 96151966 missense probably benign 0.39
R5001:Klhl1 UTSW 14 96136610 missense probably damaging 0.96
R5022:Klhl1 UTSW 14 96136706 missense probably benign 0.31
R5616:Klhl1 UTSW 14 96518293 missense probably benign 0.44
R5634:Klhl1 UTSW 14 96240271 missense probably damaging 0.96
R5700:Klhl1 UTSW 14 96518040 missense probably benign
R5701:Klhl1 UTSW 14 96201380 missense probably benign
R5934:Klhl1 UTSW 14 96123215 critical splice donor site probably null
R5950:Klhl1 UTSW 14 96240354 missense probably damaging 0.99
R6454:Klhl1 UTSW 14 96280091 missense possibly damaging 0.66
R6496:Klhl1 UTSW 14 96240216 missense probably benign 0.03
R6606:Klhl1 UTSW 14 96123222 missense possibly damaging 0.52
R6644:Klhl1 UTSW 14 96517918 missense probably benign
R6745:Klhl1 UTSW 14 96280002 critical splice donor site probably null
R6919:Klhl1 UTSW 14 96136594 missense probably benign 0.00
R7029:Klhl1 UTSW 14 96518196 missense probably benign 0.01
R7195:Klhl1 UTSW 14 96280077 missense probably benign 0.08
R7467:Klhl1 UTSW 14 96123277 missense probably damaging 1.00
R7483:Klhl1 UTSW 14 96346868 missense probably benign 0.09
R7650:Klhl1 UTSW 14 96346943 missense probably damaging 0.96
R7817:Klhl1 UTSW 14 96136750 missense possibly damaging 0.91
R8221:Klhl1 UTSW 14 96280110 missense possibly damaging 0.69
R8444:Klhl1 UTSW 14 96517890 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAACAGCTCCTGTCTCATTTG -3'
(R):5'- ATCTTCCCAGTAGTTGACAGCC -3'

Sequencing Primer
(F):5'- ACCATGGTGTAGCTGTGT -3'
(R):5'- TCAGGGCAGTCTAACATTCCAAGTG -3'
Posted On2015-04-17