Incidental Mutation 'R3925:Onecut2'
ID308256
Institutional Source Beutler Lab
Gene Symbol Onecut2
Ensembl Gene ENSMUSG00000045991
Gene Nameone cut domain, family member 2
SynonymsOc2, OC-2
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.770) question?
Stock #R3925 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location64340364-64398488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64341520 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 381 (K381E)
Ref Sequence ENSEMBL: ENSMUSP00000110798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115145] [ENSMUST00000175965]
Predicted Effect probably damaging
Transcript: ENSMUST00000115145
AA Change: K381E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110798
Gene: ENSMUSG00000045991
AA Change: K381E

DomainStartEndE-ValueType
low complexity region 34 56 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 146 158 N/A INTRINSIC
low complexity region 167 185 N/A INTRINSIC
low complexity region 311 323 N/A INTRINSIC
CUT 326 411 1e-42 SMART
HOX 427 489 2.63e-12 SMART
low complexity region 491 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175965
AA Change: K362E

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135692
Gene: ENSMUSG00000045991
AA Change: K362E

DomainStartEndE-ValueType
low complexity region 15 37 N/A INTRINSIC
low complexity region 73 92 N/A INTRINSIC
low complexity region 127 139 N/A INTRINSIC
low complexity region 148 166 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
CUT 307 392 1e-42 SMART
HOX 408 470 2.63e-12 SMART
low complexity region 472 482 N/A INTRINSIC
Meta Mutation Damage Score 0.7100 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the onecut family of transcription factors, which are characterized by a cut domain and an atypical homeodomain. The protein binds to specific DNA sequences and stimulates expression of target genes, including genes involved in melanocyte and hepatocyte differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in abnormal bile duct development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Onecut2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01350:Onecut2 APN 18 64341089 missense probably damaging 1.00
IGL01712:Onecut2 APN 18 64386602 missense probably damaging 0.97
IGL01925:Onecut2 APN 18 64341514 missense probably damaging 1.00
IGL03105:Onecut2 APN 18 64341508 nonsense probably null
R0197:Onecut2 UTSW 18 64341472 missense possibly damaging 0.91
R0504:Onecut2 UTSW 18 64340749 missense possibly damaging 0.72
R1514:Onecut2 UTSW 18 64341580 missense possibly damaging 0.93
R2314:Onecut2 UTSW 18 64341197 missense probably damaging 0.99
R3923:Onecut2 UTSW 18 64341520 missense probably damaging 0.98
R3924:Onecut2 UTSW 18 64341520 missense probably damaging 0.98
R4888:Onecut2 UTSW 18 64340927 missense possibly damaging 0.86
R5818:Onecut2 UTSW 18 64340975 missense possibly damaging 0.53
R5995:Onecut2 UTSW 18 64341548 missense probably damaging 0.99
R7132:Onecut2 UTSW 18 64340912 missense possibly damaging 0.79
R7232:Onecut2 UTSW 18 64341562 missense probably damaging 1.00
R7250:Onecut2 UTSW 18 64386440 missense probably benign 0.21
R7631:Onecut2 UTSW 18 64340975 missense possibly damaging 0.53
R7887:Onecut2 UTSW 18 64340975 missense possibly damaging 0.53
R7891:Onecut2 UTSW 18 64340975 missense possibly damaging 0.53
R7900:Onecut2 UTSW 18 64341587 missense probably damaging 0.97
R8176:Onecut2 UTSW 18 64340860 missense possibly damaging 0.62
Z1177:Onecut2 UTSW 18 64341307 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AATGGCTTACACCACCCTGG -3'
(R):5'- ACTGGCAATGAAAACTCAGAGTC -3'

Sequencing Primer
(F):5'- CTCCTCGGGTTCTCAGGTG -3'
(R):5'- AACTCAGAGTCAAGGAGTGTG -3'
Posted On2015-04-17