Incidental Mutation 'R3926:Ddx59'
ID308262
Institutional Source Beutler Lab
Gene Symbol Ddx59
Ensembl Gene ENSMUSG00000026404
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 59
Synonyms
MMRRC Submission 040821-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3926 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136415271-136440158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136416744 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 51 (V51D)
Ref Sequence ENSEMBL: ENSMUSP00000027655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027655]
Predicted Effect probably benign
Transcript: ENSMUST00000027655
AA Change: V51D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027655
Gene: ENSMUSG00000026404
AA Change: V51D

DomainStartEndE-ValueType
Pfam:zf-HIT 104 133 5.5e-11 PFAM
DEXDc 222 420 5.43e-55 SMART
HELICc 458 540 1.79e-23 SMART
low complexity region 583 596 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194227
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Asb14 T C 14: 26,897,738 I48T possibly damaging Het
Astn1 A T 1: 158,579,657 I559F possibly damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
Bco1 T C 8: 117,127,472 S379P probably benign Het
Bst1 T C 5: 43,840,454 V265A possibly damaging Het
Car11 T C 7: 45,700,491 F45L probably benign Het
Cdkl2 T C 5: 92,033,139 I214V possibly damaging Het
Cluap1 T A 16: 3,911,534 S141T probably damaging Het
Col11a1 C T 3: 114,090,124 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Corin T G 5: 72,372,130 D294A probably damaging Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx41 A G 13: 55,531,270 L559P probably damaging Het
Dennd1b A G 1: 139,143,959 N397D probably benign Het
Evc2 T A 5: 37,383,230 L590Q probably damaging Het
Fhl5 A T 4: 25,214,790 probably benign Het
Flg2 A G 3: 93,203,215 Y850C unknown Het
Gal3st2b G T 1: 93,940,790 V246L probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Jam3 A T 9: 27,106,405 I29K possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lims2 A G 18: 31,957,943 S327G probably benign Het
Lynx1 A G 15: 74,751,356 Y76H probably damaging Het
Mycbp2 G A 14: 103,204,500 P1943L probably damaging Het
Myo3a A G 2: 22,565,041 D86G probably damaging Het
Nkx3-2 T A 5: 41,761,880 Q255L probably damaging Het
Notch3 C T 17: 32,153,557 R641H possibly damaging Het
Nr2c2 T A 6: 92,160,401 M431K probably damaging Het
Ogfod3 T C 11: 121,183,429 T265A probably damaging Het
Pcdh9 G T 14: 93,886,810 Y641* probably null Het
Pcdha9 T A 18: 36,999,412 D511E probably damaging Het
Pcdhgb8 A G 18: 37,762,390 Y171C probably damaging Het
Pcnx T C 12: 81,958,731 C1075R probably damaging Het
Pik3c3 C A 18: 30,311,329 probably benign Het
Pkhd1 T C 1: 20,550,873 T854A probably benign Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Rhof T C 5: 123,104,530 probably null Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Serpina3f T C 12: 104,219,481 I315T possibly damaging Het
Slc1a6 T A 10: 78,812,881 S479T possibly damaging Het
Tmcc1 T C 6: 116,042,913 D166G probably damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Zfp217 T C 2: 170,112,518 D1038G probably damaging Het
Zfp709 A G 8: 71,890,553 R609G probably damaging Het
Zfp729a T A 13: 67,620,191 K640* probably null Het
Zfp986 A T 4: 145,892,520 probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Ddx59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Ddx59 APN 1 136433827 missense probably damaging 0.99
IGL02191:Ddx59 APN 1 136417158 missense probably damaging 1.00
IGL02525:Ddx59 APN 1 136417005 missense probably benign 0.03
IGL02712:Ddx59 APN 1 136439781 missense probably benign 0.14
R0219:Ddx59 UTSW 1 136432309 splice site probably benign
R0898:Ddx59 UTSW 1 136416941 missense probably damaging 1.00
R1728:Ddx59 UTSW 1 136417053 missense probably benign
R1729:Ddx59 UTSW 1 136417053 missense probably benign
R1730:Ddx59 UTSW 1 136417053 missense probably benign
R1739:Ddx59 UTSW 1 136417053 missense probably benign
R1762:Ddx59 UTSW 1 136417053 missense probably benign
R1783:Ddx59 UTSW 1 136417053 missense probably benign
R1784:Ddx59 UTSW 1 136417053 missense probably benign
R1785:Ddx59 UTSW 1 136417053 missense probably benign
R1817:Ddx59 UTSW 1 136432507 missense probably damaging 0.98
R1818:Ddx59 UTSW 1 136432507 missense probably damaging 0.98
R1819:Ddx59 UTSW 1 136432507 missense probably damaging 0.98
R2091:Ddx59 UTSW 1 136416709 missense probably benign
R3922:Ddx59 UTSW 1 136416744 missense probably benign
R3923:Ddx59 UTSW 1 136416744 missense probably benign
R3945:Ddx59 UTSW 1 136434618 missense probably damaging 0.99
R4182:Ddx59 UTSW 1 136439861 missense probably benign 0.01
R4589:Ddx59 UTSW 1 136439742 splice site probably null
R4636:Ddx59 UTSW 1 136432563 missense probably damaging 0.96
R4721:Ddx59 UTSW 1 136417106 missense probably benign 0.00
R5276:Ddx59 UTSW 1 136419448 missense probably damaging 1.00
R6318:Ddx59 UTSW 1 136416872 missense probably damaging 0.99
R7602:Ddx59 UTSW 1 136433821 missense probably benign 0.01
Z1088:Ddx59 UTSW 1 136432451 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CATGGTGCAATTTCCTCAACAG -3'
(R):5'- TCCAAGCTACACACGTCTTCG -3'

Sequencing Primer
(F):5'- CAGAATGTTGAAGAATGTTTGTTCC -3'
(R):5'- TGTCACAGATATACTCTCCATAACG -3'
Posted On2015-04-17