Mutagenetix > Incidental Mutations

Incidental Mutation 'R3926:Myo3a'

308265

Institutional Source

Beutler Lab

Gene Symbol

Myo3a

Ensembl Gene

ENSMUSG00000025716

Gene Name

myosin IIIA

Synonyms

9030416P08Rik

MMRRC Submission

040821-MU

Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3926 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22227503-22618252 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22565041 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 86 (D86G)

Ref Sequence

ENSEMBL: ENSMUSP00000116185 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000138863]

Predicted Effect

probably benign
Transcript: ENSMUST00000044749
AA Change: D1024G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: D1024G

Domain	Start	End	E-Value	Type
S_TKc	29	295	1.62e-91	SMART
MYSc	340	1061	2.07e-252	SMART
IQ	1061	1083	2.88e1	SMART
IQ	1088	1110	9.48e-3	SMART
low complexity region	1153	1169	N/A	INTRINSIC
low complexity region	1359	1369	N/A	INTRINSIC
low complexity region	1496	1505	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000138863
AA Change: D86G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000116185
Gene: ENSMUSG00000025716
AA Change: D86G

Domain	Start	End	E-Value	Type
Pfam:Myosin_head	1	110	1.7e-28	PFAM
IQ	123	145	2.88e1	SMART
IQ	150	172	9.48e-3	SMART
low complexity region	215	231	N/A	INTRINSIC
low complexity region	421	431	N/A	INTRINSIC
low complexity region	558	567	N/A	INTRINSIC

Meta Mutation Damage Score

0.2068

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.6%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Ahnak	G	A	19: 9,006,328	D1659N	probably benign	Het
Arfgap2	C	T	2: 91,274,805	R405W	probably damaging	Het
Asb14	T	C	14: 26,897,738	I48T	possibly damaging	Het
Astn1	A	T	1: 158,579,657	I559F	possibly damaging	Het
Atg7	C	T	6: 114,673,678	T83M	possibly damaging	Het
Bco1	T	C	8: 117,127,472	S379P	probably benign	Het
Bst1	T	C	5: 43,840,454	V265A	possibly damaging	Het
Car11	T	C	7: 45,700,491	F45L	probably benign	Het
Cdkl2	T	C	5: 92,033,139	I214V	possibly damaging	Het
Cluap1	T	A	16: 3,911,534	S141T	probably damaging	Het
Col11a1	C	T	3: 114,090,124		probably benign	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Corin	T	G	5: 72,372,130	D294A	probably damaging	Het
Crct1	C	A	3: 93,014,707		probably benign	Het
Ddx41	A	G	13: 55,531,270	L559P	probably damaging	Het
Ddx59	T	A	1: 136,416,744	V51D	probably benign	Het
Dennd1b	A	G	1: 139,143,959	N397D	probably benign	Het
Evc2	T	A	5: 37,383,230	L590Q	probably damaging	Het
Fhl5	A	T	4: 25,214,790		probably benign	Het
Flg2	A	G	3: 93,203,215	Y850C	unknown	Het
Gal3st2b	G	T	1: 93,940,790	V246L	probably benign	Het
Gm38100	T	C	1: 175,921,286	V306A	probably benign	Het
Jam3	A	T	9: 27,106,405	I29K	possibly damaging	Het
Klhl1	A	T	14: 96,346,880	C305S	possibly damaging	Het
Lims2	A	G	18: 31,957,943	S327G	probably benign	Het
Lynx1	A	G	15: 74,751,356	Y76H	probably damaging	Het
Mycbp2	G	A	14: 103,204,500	P1943L	probably damaging	Het
Nkx3-2	T	A	5: 41,761,880	Q255L	probably damaging	Het
Notch3	C	T	17: 32,153,557	R641H	possibly damaging	Het
Nr2c2	T	A	6: 92,160,401	M431K	probably damaging	Het
Ogfod3	T	C	11: 121,183,429	T265A	probably damaging	Het
Pcdh9	G	T	14: 93,886,810	Y641*	probably null	Het
Pcdha9	T	A	18: 36,999,412	D511E	probably damaging	Het
Pcdhgb8	A	G	18: 37,762,390	Y171C	probably damaging	Het
Pcnx	T	C	12: 81,958,731	C1075R	probably damaging	Het
Pik3c3	C	A	18: 30,311,329		probably benign	Het
Pkhd1	T	C	1: 20,550,873	T854A	probably benign	Het
Pycr1	T	C	11: 120,642,135	T100A	probably benign	Het
Rhof	T	C	5: 123,104,530		probably null	Het
Scn9a	T	A	2: 66,526,873	D1028V	possibly damaging	Het
Serpina3f	T	C	12: 104,219,481	I315T	possibly damaging	Het
Slc1a6	T	A	10: 78,812,881	S479T	possibly damaging	Het
Tmcc1	T	C	6: 116,042,913	D166G	probably damaging	Het
Trav3-3	A	G	14: 53,666,371	K49E	probably benign	Het
Usp28	T	C	9: 49,030,923		probably null	Het
Utrn	C	T	10: 12,698,042	V1095I	probably benign	Het
Zfp217	T	C	2: 170,112,518	D1038G	probably damaging	Het
Zfp709	A	G	8: 71,890,553	R609G	probably damaging	Het
Zfp729a	T	A	13: 67,620,191	K640*	probably null	Het
Zfp986	A	T	4: 145,892,520		probably benign	Het
Zkscan6	A	T	11: 65,828,225	H357L	probably benign	Het

Other mutations in Myo3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01014:Myo3a	APN	2	22332473	missense	probably benign	0.42
IGL01307:Myo3a	APN	2	22558289	missense	probably damaging	1.00
IGL01413:Myo3a	APN	2	22297600	missense	probably benign	0.25
IGL01655:Myo3a	APN	2	22423326	missense	probably damaging	1.00
IGL01767:Myo3a	APN	2	22423222	missense	probably damaging	0.96
IGL01803:Myo3a	APN	2	22241115	missense	probably damaging	1.00
IGL01969:Myo3a	APN	2	22297688	missense	probably benign	0.03
IGL02043:Myo3a	APN	2	22399965	missense	probably benign	0.01
IGL02124:Myo3a	APN	2	22577526	missense	probably benign	0.01
IGL02174:Myo3a	APN	2	22332393	missense	probably benign	0.04
IGL02649:Myo3a	APN	2	22323607	missense	probably benign
IGL02976:Myo3a	APN	2	22542452	nonsense	probably null
IGL03328:Myo3a	APN	2	22578198	missense	probably benign	0.02
IGL03376:Myo3a	APN	2	22600074	splice site	probably benign
lose	UTSW	2	22558320	nonsense	probably null
snooze	UTSW	2	22282634	missense	probably damaging	0.99
A5278:Myo3a	UTSW	2	22323653	missense	probably benign	0.27
PIT4445001:Myo3a	UTSW	2	22542415	missense	possibly damaging	0.64
R0008:Myo3a	UTSW	2	22579741	missense	probably damaging	0.99
R0099:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0103:Myo3a	UTSW	2	22544322	splice site	probably benign
R0212:Myo3a	UTSW	2	22291848	missense	probably damaging	1.00
R0281:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0282:Myo3a	UTSW	2	22245598	missense	probably benign	0.03
R0492:Myo3a	UTSW	2	22323636	missense	possibly damaging	0.46
R0498:Myo3a	UTSW	2	22577429	missense	possibly damaging	0.74
R0594:Myo3a	UTSW	2	22544332	splice site	probably benign
R0609:Myo3a	UTSW	2	22333513	missense	probably benign	0.29
R0609:Myo3a	UTSW	2	22396299	missense	possibly damaging	0.95
R0827:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R0968:Myo3a	UTSW	2	22558289	missense	probably damaging	1.00
R1157:Myo3a	UTSW	2	22542414	critical splice acceptor site	probably null
R1301:Myo3a	UTSW	2	22267095	splice site	probably benign
R1352:Myo3a	UTSW	2	22323675	critical splice donor site	probably null
R1443:Myo3a	UTSW	2	22282626	missense	probably damaging	0.99
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1465:Myo3a	UTSW	2	22577927	missense	probably benign	0.00
R1517:Myo3a	UTSW	2	22282634	missense	probably damaging	0.99
R1565:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1712:Myo3a	UTSW	2	22564992	missense	probably damaging	1.00
R1722:Myo3a	UTSW	2	22399827	missense	probably benign	0.03
R1822:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1823:Myo3a	UTSW	2	22340280	missense	probably damaging	1.00
R1824:Myo3a	UTSW	2	22396243	missense	probably benign
R1837:Myo3a	UTSW	2	22577592	missense	possibly damaging	0.76
R1867:Myo3a	UTSW	2	22399846	missense	probably benign	0.00
R1917:Myo3a	UTSW	2	22291922	missense	probably damaging	1.00
R1920:Myo3a	UTSW	2	22564996	missense	probably benign	0.02
R1937:Myo3a	UTSW	2	22396315	missense	probably damaging	1.00
R1954:Myo3a	UTSW	2	22241226	missense	probably damaging	1.00
R1988:Myo3a	UTSW	2	22578128	missense	possibly damaging	0.86
R2091:Myo3a	UTSW	2	22333677	missense	probably damaging	0.99
R2115:Myo3a	UTSW	2	22245531	missense	probably damaging	1.00
R2125:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2126:Myo3a	UTSW	2	22578174	missense	probably benign	0.42
R2216:Myo3a	UTSW	2	22577771	missense	probably benign	0.00
R2413:Myo3a	UTSW	2	22577912	missense	probably benign	0.00
R2964:Myo3a	UTSW	2	22340256	missense	possibly damaging	0.90
R3196:Myo3a	UTSW	2	22399868	missense	possibly damaging	0.86
R3837:Myo3a	UTSW	2	22565109	splice site	probably benign
R3905:Myo3a	UTSW	2	22558215	missense	probably damaging	1.00
R4014:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4015:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4017:Myo3a	UTSW	2	22578170	missense	possibly damaging	0.76
R4043:Myo3a	UTSW	2	22333539	splice site	probably benign
R4044:Myo3a	UTSW	2	22577700	missense	probably damaging	0.99
R4057:Myo3a	UTSW	2	22266160	missense	probably benign	0.01
R4192:Myo3a	UTSW	2	22407377	missense	probably damaging	1.00
R4282:Myo3a	UTSW	2	22340278	missense	probably benign	0.14
R4321:Myo3a	UTSW	2	22267155	missense	probably damaging	1.00
R4393:Myo3a	UTSW	2	22577854	missense	probably damaging	0.99
R4398:Myo3a	UTSW	2	22577842	missense	probably benign
R4446:Myo3a	UTSW	2	22600137	missense	probably damaging	1.00
R4685:Myo3a	UTSW	2	22407422	missense	probably damaging	1.00
R5032:Myo3a	UTSW	2	22282602	missense	probably damaging	1.00
R5096:Myo3a	UTSW	2	22574242	missense	probably benign	0.16
R5183:Myo3a	UTSW	2	22578158	missense	probably benign	0.05
R5458:Myo3a	UTSW	2	22245550	missense	probably damaging	1.00
R5502:Myo3a	UTSW	2	22558369	missense	probably damaging	1.00
R5522:Myo3a	UTSW	2	22574341	missense	probably damaging	1.00
R6462:Myo3a	UTSW	2	22558411	missense	probably damaging	1.00
R6479:Myo3a	UTSW	2	22577865	missense	probably benign	0.00
R6513:Myo3a	UTSW	2	22407332	missense	probably damaging	1.00
R6520:Myo3a	UTSW	2	22399926	missense	possibly damaging	0.90
R6602:Myo3a	UTSW	2	22577787	missense	probably damaging	0.96
R6671:Myo3a	UTSW	2	22294522	missense	probably damaging	1.00
R6743:Myo3a	UTSW	2	22361664	missense	probably benign	0.24
R6865:Myo3a	UTSW	2	22574301	missense	probably benign	0.00
R6961:Myo3a	UTSW	2	22245558	missense	probably benign	0.00
R7001:Myo3a	UTSW	2	22332377	missense	probably benign	0.04
R7215:Myo3a	UTSW	2	22245567	missense	possibly damaging	0.78
R7301:Myo3a	UTSW	2	22544466	critical splice donor site	probably null
R7318:Myo3a	UTSW	2	22558320	nonsense	probably null
R7447:Myo3a	UTSW	2	22544426	missense	probably benign	0.27
R7456:Myo3a	UTSW	2	22407444	missense	probably benign	0.08
R7528:Myo3a	UTSW	2	22266114	nonsense	probably null
R7731:Myo3a	UTSW	2	22282589	missense	probably damaging	1.00
R7768:Myo3a	UTSW	2	22241143	missense	probably damaging	0.99
R8054:Myo3a	UTSW	2	22574317	missense	probably benign	0.00
Z1177:Myo3a	UTSW	2	22618140	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- GGGAGCCAAGCATTAAATCTG -3'
(R):5'- TTTACTGCCAGTGCCATTGGG -3'

Sequencing Primer
(F):5'- GCATTAAATCTGGGAATCTCAGCC -3'
(R):5'- GCAGTGTCATTCCTAGGCAAC -3'

Posted On

2015-04-17