Incidental Mutation 'R3926:Nr2c2'
ID308280
Institutional Source Beutler Lab
Gene Symbol Nr2c2
Ensembl Gene ENSMUSG00000005893
Gene Namenuclear receptor subfamily 2, group C, member 2
SynonymsTAK1, Tr4
MMRRC Submission 040821-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.610) question?
Stock #R3926 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location92091390-92174294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92160401 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 431 (M431K)
Ref Sequence ENSEMBL: ENSMUSP00000109090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113460] [ENSMUST00000113463] [ENSMUST00000146175]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113460
AA Change: M398K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109087
Gene: ENSMUSG00000005893
AA Change: M398K

DomainStartEndE-ValueType
ZnF_C4 114 185 4.33e-40 SMART
Blast:HOLI 238 324 4e-46 BLAST
HOLI 388 554 1.9e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113463
AA Change: M431K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109090
Gene: ENSMUSG00000005893
AA Change: M431K

DomainStartEndE-ValueType
ZnF_C4 147 218 4.33e-40 SMART
Blast:HOLI 271 357 6e-46 BLAST
HOLI 421 587 1.9e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133321
Predicted Effect possibly damaging
Transcript: ENSMUST00000146175
AA Change: M398K

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138465
Gene: ENSMUSG00000005893
AA Change: M398K

DomainStartEndE-ValueType
ZnF_C4 114 185 4.33e-40 SMART
Blast:HOLI 238 324 7e-47 BLAST
Pfam:Hormone_recep 367 493 8.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204497
Meta Mutation Damage Score 0.9646 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the nuclear hormone receptor family. Members of this family act as ligand-activated transcription factors and function in many biological processes such as development, cellular differentiation and homeostasis. The activated receptor/ligand complex is translocated to the nucleus where it binds to hormone response elements of target genes. The protein encoded by this gene plays a role in protecting cells from oxidative stress and damage induced by ionizing radiation. The lack of a similar gene in mouse results in growth retardation, severe spinal curvature, subfertility, premature aging, and prostatic intraepithelial neoplasia (PIN) development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display reduced body size, reduced male fertility, and impaired spermatogenesis. Mice homozygous for a conditional allele activated in the CNS exhibit increased thermal, mechanical and chemical nociception threshold, decreased pruritus and neuronal loss in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Asb14 T C 14: 26,897,738 I48T possibly damaging Het
Astn1 A T 1: 158,579,657 I559F possibly damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
Bco1 T C 8: 117,127,472 S379P probably benign Het
Bst1 T C 5: 43,840,454 V265A possibly damaging Het
Car11 T C 7: 45,700,491 F45L probably benign Het
Cdkl2 T C 5: 92,033,139 I214V possibly damaging Het
Cluap1 T A 16: 3,911,534 S141T probably damaging Het
Col11a1 C T 3: 114,090,124 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Corin T G 5: 72,372,130 D294A probably damaging Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx41 A G 13: 55,531,270 L559P probably damaging Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dennd1b A G 1: 139,143,959 N397D probably benign Het
Evc2 T A 5: 37,383,230 L590Q probably damaging Het
Fhl5 A T 4: 25,214,790 probably benign Het
Flg2 A G 3: 93,203,215 Y850C unknown Het
Gal3st2b G T 1: 93,940,790 V246L probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Jam3 A T 9: 27,106,405 I29K possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lims2 A G 18: 31,957,943 S327G probably benign Het
Lynx1 A G 15: 74,751,356 Y76H probably damaging Het
Mycbp2 G A 14: 103,204,500 P1943L probably damaging Het
Myo3a A G 2: 22,565,041 D86G probably damaging Het
Nkx3-2 T A 5: 41,761,880 Q255L probably damaging Het
Notch3 C T 17: 32,153,557 R641H possibly damaging Het
Ogfod3 T C 11: 121,183,429 T265A probably damaging Het
Pcdh9 G T 14: 93,886,810 Y641* probably null Het
Pcdha9 T A 18: 36,999,412 D511E probably damaging Het
Pcdhgb8 A G 18: 37,762,390 Y171C probably damaging Het
Pcnx T C 12: 81,958,731 C1075R probably damaging Het
Pik3c3 C A 18: 30,311,329 probably benign Het
Pkhd1 T C 1: 20,550,873 T854A probably benign Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Rhof T C 5: 123,104,530 probably null Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Serpina3f T C 12: 104,219,481 I315T possibly damaging Het
Slc1a6 T A 10: 78,812,881 S479T possibly damaging Het
Tmcc1 T C 6: 116,042,913 D166G probably damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Zfp217 T C 2: 170,112,518 D1038G probably damaging Het
Zfp709 A G 8: 71,890,553 R609G probably damaging Het
Zfp729a T A 13: 67,620,191 K640* probably null Het
Zfp986 A T 4: 145,892,520 probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Nr2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Nr2c2 APN 6 92149719 missense probably damaging 1.00
IGL01129:Nr2c2 APN 6 92158416 missense probably benign 0.08
IGL01578:Nr2c2 APN 6 92162038 missense probably benign 0.01
IGL02281:Nr2c2 APN 6 92154514 missense probably benign 0.20
R1385:Nr2c2 UTSW 6 92154470 missense probably damaging 1.00
R1397:Nr2c2 UTSW 6 92149764 missense probably benign 0.34
R1503:Nr2c2 UTSW 6 92105331 missense probably benign
R1691:Nr2c2 UTSW 6 92156692 missense probably damaging 0.99
R1779:Nr2c2 UTSW 6 92159243 missense possibly damaging 0.50
R2655:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R3840:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R3841:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R3923:Nr2c2 UTSW 6 92160401 missense probably damaging 0.98
R3945:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R3946:Nr2c2 UTSW 6 92163138 missense probably damaging 0.99
R4721:Nr2c2 UTSW 6 92139847 missense possibly damaging 0.49
R5038:Nr2c2 UTSW 6 92139822 missense probably damaging 1.00
R5101:Nr2c2 UTSW 6 92154516 critical splice donor site probably null
R5524:Nr2c2 UTSW 6 92139765 splice site probably null
R6884:Nr2c2 UTSW 6 92158393 missense probably benign 0.05
R7046:Nr2c2 UTSW 6 92158357 missense probably damaging 1.00
R7278:Nr2c2 UTSW 6 92159378 missense probably damaging 0.96
R7316:Nr2c2 UTSW 6 92154463 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACAGTTACCATTGTTGAAACAGG -3'
(R):5'- TCCTAGCAACAAATCCTTGGC -3'

Sequencing Primer
(F):5'- CCATTGTTGAAACAGGAGATAAGTTG -3'
(R):5'- AGAACTATTGTTTCTTTCAGTCTGC -3'
Posted On2015-04-17