Incidental Mutation 'R3926:Jam3'
ID 308286
Institutional Source Beutler Lab
Gene Symbol Jam3
Ensembl Gene ENSMUSG00000031990
Gene Name junction adhesion molecule 3
Synonyms 1110002N23Rik, Jcam3, JAM-3, JAM-C
MMRRC Submission 040821-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.592) question?
Stock # R3926 (G1)
Quality Score 207
Status Validated
Chromosome 9
Chromosomal Location 27008680-27066717 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27017701 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 29 (I29K)
Ref Sequence ENSEMBL: ENSMUSP00000034472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034472]
AlphaFold Q9D8B7
Predicted Effect possibly damaging
Transcript: ENSMUST00000034472
AA Change: I29K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000034472
Gene: ENSMUSG00000031990
AA Change: I29K

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IG 38 136 2.7e-9 SMART
IGc2 151 226 8.12e-13 SMART
transmembrane domain 245 267 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167074
SMART Domains Protein: ENSMUSP00000128003
Gene: ENSMUSG00000031990

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 18 24 N/A INTRINSIC
IG 38 136 2.7e-9 SMART
Pfam:C2-set_2 138 206 4.8e-7 PFAM
Pfam:Ig_3 139 206 7.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215446
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217654
Meta Mutation Damage Score 0.1342 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is localized in the tight junctions between high endothelial cells. Unlike other proteins in this family, the this protein is unable to adhere to leukocyte cell lines and only forms weak homotypic interactions. The encoded protein is a member of the junctional adhesion molecule protein family and acts as a receptor for another member of this family. A mutation in an intron of this gene is associated with hemorrhagic destruction of the brain, subependymal calcification, and congenital cataracts. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2011]
PHENOTYPE: Approximately 60% of mice homozygous for a targeted mutation exhibit postnatal lethality. Males are infertile and display small testes and arrested differentiation of round spermatids into spermatozoa, as shown by the absence of acrosomes, elongated nuclei, and morphological signs of polarization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
Ahnak G A 19: 8,983,692 (GRCm39) D1659N probably benign Het
Arfgap2 C T 2: 91,105,150 (GRCm39) R405W probably damaging Het
Asb14 T C 14: 26,619,695 (GRCm39) I48T possibly damaging Het
Astn1 A T 1: 158,407,227 (GRCm39) I559F possibly damaging Het
Atg7 C T 6: 114,650,639 (GRCm39) T83M possibly damaging Het
Bco1 T C 8: 117,854,211 (GRCm39) S379P probably benign Het
Becn2 T C 1: 175,748,852 (GRCm39) V306A probably benign Het
Bst1 T C 5: 43,997,796 (GRCm39) V265A possibly damaging Het
Car11 T C 7: 45,349,915 (GRCm39) F45L probably benign Het
Cdkl2 T C 5: 92,180,998 (GRCm39) I214V possibly damaging Het
Cluap1 T A 16: 3,729,398 (GRCm39) S141T probably damaging Het
Col11a1 C T 3: 113,883,773 (GRCm39) probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Corin T G 5: 72,529,473 (GRCm39) D294A probably damaging Het
Crct1 C A 3: 92,922,014 (GRCm39) probably benign Het
Ddx41 A G 13: 55,679,083 (GRCm39) L559P probably damaging Het
Ddx59 T A 1: 136,344,482 (GRCm39) V51D probably benign Het
Dennd1b A G 1: 139,071,697 (GRCm39) N397D probably benign Het
Evc2 T A 5: 37,540,574 (GRCm39) L590Q probably damaging Het
Fhl5 A T 4: 25,214,790 (GRCm39) probably benign Het
Flg2 A G 3: 93,110,522 (GRCm39) Y850C unknown Het
Gal3st2b G T 1: 93,868,512 (GRCm39) V246L probably benign Het
Klhl1 A T 14: 96,584,316 (GRCm39) C305S possibly damaging Het
Lims2 A G 18: 32,090,996 (GRCm39) S327G probably benign Het
Lynx1 A G 15: 74,623,205 (GRCm39) Y76H probably damaging Het
Mycbp2 G A 14: 103,441,936 (GRCm39) P1943L probably damaging Het
Myo3a A G 2: 22,455,053 (GRCm39) D86G probably damaging Het
Nkx3-2 T A 5: 41,919,223 (GRCm39) Q255L probably damaging Het
Notch3 C T 17: 32,372,531 (GRCm39) R641H possibly damaging Het
Nr2c2 T A 6: 92,137,382 (GRCm39) M431K probably damaging Het
Ogfod3 T C 11: 121,074,255 (GRCm39) T265A probably damaging Het
Pcdh9 G T 14: 94,124,246 (GRCm39) Y641* probably null Het
Pcdha9 T A 18: 37,132,465 (GRCm39) D511E probably damaging Het
Pcdhgb8 A G 18: 37,895,443 (GRCm39) Y171C probably damaging Het
Pcnx1 T C 12: 82,005,505 (GRCm39) C1075R probably damaging Het
Pik3c3 C A 18: 30,444,382 (GRCm39) probably benign Het
Pkhd1 T C 1: 20,621,097 (GRCm39) T854A probably benign Het
Pycr1 T C 11: 120,532,961 (GRCm39) T100A probably benign Het
Rhof T C 5: 123,242,593 (GRCm39) probably null Het
Scn9a T A 2: 66,357,217 (GRCm39) D1028V possibly damaging Het
Serpina3f T C 12: 104,185,740 (GRCm39) I315T possibly damaging Het
Slc1a6 T A 10: 78,648,715 (GRCm39) S479T possibly damaging Het
Tmcc1 T C 6: 116,019,874 (GRCm39) D166G probably damaging Het
Trav3-3 A G 14: 53,903,828 (GRCm39) K49E probably benign Het
Usp28 T C 9: 48,942,223 (GRCm39) probably null Het
Utrn C T 10: 12,573,786 (GRCm39) V1095I probably benign Het
Zfp217 T C 2: 169,954,438 (GRCm39) D1038G probably damaging Het
Zfp709 A G 8: 72,644,397 (GRCm39) R609G probably damaging Het
Zfp729a T A 13: 67,768,310 (GRCm39) K640* probably null Het
Zfp986 A T 4: 145,619,090 (GRCm39) probably benign Het
Zkscan6 A T 11: 65,719,051 (GRCm39) H357L probably benign Het
Other mutations in Jam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Jam3 APN 9 27,013,188 (GRCm39) missense probably damaging 1.00
IGL01311:Jam3 APN 9 27,010,019 (GRCm39) missense probably damaging 0.99
IGL01729:Jam3 APN 9 27,016,821 (GRCm39) missense probably damaging 1.00
IGL03233:Jam3 APN 9 27,013,217 (GRCm39) missense probably damaging 1.00
IGL03275:Jam3 APN 9 27,012,545 (GRCm39) missense probably damaging 0.99
R0267:Jam3 UTSW 9 27,017,701 (GRCm39) missense probably benign 0.01
R0547:Jam3 UTSW 9 27,010,184 (GRCm39) missense probably damaging 1.00
R0899:Jam3 UTSW 9 27,010,253 (GRCm39) missense probably damaging 1.00
R1499:Jam3 UTSW 9 27,017,701 (GRCm39) missense possibly damaging 0.93
R4044:Jam3 UTSW 9 27,013,159 (GRCm39) critical splice donor site probably null
R4977:Jam3 UTSW 9 27,009,669 (GRCm39) missense probably damaging 0.96
R6527:Jam3 UTSW 9 27,066,640 (GRCm39) missense unknown
R6759:Jam3 UTSW 9 27,013,276 (GRCm39) missense probably benign 0.09
R7843:Jam3 UTSW 9 27,017,712 (GRCm39) critical splice acceptor site probably null
R8088:Jam3 UTSW 9 27,010,156 (GRCm39) missense probably benign 0.00
R9688:Jam3 UTSW 9 27,010,204 (GRCm39) missense probably benign 0.30
R9700:Jam3 UTSW 9 27,010,183 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTTGGCTAGTCCATACAGG -3'
(R):5'- CTGTTCTTTGCTGCCATGAG -3'

Sequencing Primer
(F):5'- TAGTGAATTCCATGTCAGCCAGAGC -3'
(R):5'- TCCACCCAGAGTTTCTTG -3'
Posted On 2015-04-17