Incidental Mutation 'R3926:Zfp729a'
ID308298
Institutional Source Beutler Lab
Gene Symbol Zfp729a
Ensembl Gene ENSMUSG00000021510
Gene Namezinc finger protein 729a
SynonymsA530054K11Rik
MMRRC Submission 040821-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3926 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67612763-67637791 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 67620191 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 640 (K640*)
Ref Sequence ENSEMBL: ENSMUSP00000012314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012314] [ENSMUST00000224814] [ENSMUST00000225627]
Predicted Effect probably null
Transcript: ENSMUST00000012314
AA Change: K640*
SMART Domains Protein: ENSMUSP00000012314
Gene: ENSMUSG00000021510
AA Change: K640*

DomainStartEndE-ValueType
KRAB 15 75 6.23e-34 SMART
ZnF_C2H2 91 111 1.91e1 SMART
ZnF_C2H2 147 169 8.34e-3 SMART
PHD 148 209 9.1e0 SMART
ZnF_C2H2 175 197 3.21e-4 SMART
ZnF_C2H2 203 225 6.78e-3 SMART
ZnF_C2H2 231 253 4.47e-3 SMART
PHD 232 293 1.11e1 SMART
RING 233 292 9.27e0 SMART
ZnF_C2H2 259 281 6.67e-2 SMART
ZnF_C2H2 287 309 1.12e-3 SMART
ZnF_C2H2 315 337 3.83e-2 SMART
PHD 316 377 1.35e1 SMART
ZnF_C2H2 343 365 2.57e-3 SMART
ZnF_C2H2 371 393 1.98e-4 SMART
Pfam:zf-C2HC_2 402 422 7.7e-4 PFAM
ZnF_C2H2 427 449 1.67e-2 SMART
ZnF_C2H2 455 477 1.38e-3 SMART
PHD 456 517 5.33e0 SMART
RING 457 516 9.02e0 SMART
ZnF_C2H2 483 505 3.89e-3 SMART
ZnF_C2H2 511 533 7.49e-5 SMART
ZnF_C2H2 539 561 5.5e-3 SMART
PHD 540 601 1.46e1 SMART
ZnF_C2H2 567 589 3.58e-2 SMART
ZnF_C2H2 595 617 8.34e-3 SMART
ZnF_C2H2 651 673 4.11e-2 SMART
PHD 652 713 4.64e0 SMART
RING 653 712 6.37e0 SMART
ZnF_C2H2 679 701 2.4e-3 SMART
ZnF_C2H2 707 729 1.03e-2 SMART
ZnF_C2H2 735 757 1.47e-3 SMART
PHD 736 797 5.44e0 SMART
RING 737 796 5.88e0 SMART
ZnF_C2H2 763 785 6.67e-2 SMART
ZnF_C2H2 791 813 2.36e-2 SMART
ZnF_C2H2 819 841 6.32e-3 SMART
ZnF_C2H2 847 869 1.26e-2 SMART
ZnF_C2H2 875 897 6.78e-3 SMART
PHD 876 937 4.55e0 SMART
ZnF_C2H2 903 925 9.58e-3 SMART
ZnF_C2H2 931 953 9.08e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224548
Predicted Effect probably benign
Transcript: ENSMUST00000224814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225608
Predicted Effect probably benign
Transcript: ENSMUST00000225627
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Asb14 T C 14: 26,897,738 I48T possibly damaging Het
Astn1 A T 1: 158,579,657 I559F possibly damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
Bco1 T C 8: 117,127,472 S379P probably benign Het
Bst1 T C 5: 43,840,454 V265A possibly damaging Het
Car11 T C 7: 45,700,491 F45L probably benign Het
Cdkl2 T C 5: 92,033,139 I214V possibly damaging Het
Cluap1 T A 16: 3,911,534 S141T probably damaging Het
Col11a1 C T 3: 114,090,124 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Corin T G 5: 72,372,130 D294A probably damaging Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx41 A G 13: 55,531,270 L559P probably damaging Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dennd1b A G 1: 139,143,959 N397D probably benign Het
Evc2 T A 5: 37,383,230 L590Q probably damaging Het
Fhl5 A T 4: 25,214,790 probably benign Het
Flg2 A G 3: 93,203,215 Y850C unknown Het
Gal3st2b G T 1: 93,940,790 V246L probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Jam3 A T 9: 27,106,405 I29K possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lims2 A G 18: 31,957,943 S327G probably benign Het
Lynx1 A G 15: 74,751,356 Y76H probably damaging Het
Mycbp2 G A 14: 103,204,500 P1943L probably damaging Het
Myo3a A G 2: 22,565,041 D86G probably damaging Het
Nkx3-2 T A 5: 41,761,880 Q255L probably damaging Het
Notch3 C T 17: 32,153,557 R641H possibly damaging Het
Nr2c2 T A 6: 92,160,401 M431K probably damaging Het
Ogfod3 T C 11: 121,183,429 T265A probably damaging Het
Pcdh9 G T 14: 93,886,810 Y641* probably null Het
Pcdha9 T A 18: 36,999,412 D511E probably damaging Het
Pcdhgb8 A G 18: 37,762,390 Y171C probably damaging Het
Pcnx T C 12: 81,958,731 C1075R probably damaging Het
Pik3c3 C A 18: 30,311,329 probably benign Het
Pkhd1 T C 1: 20,550,873 T854A probably benign Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Rhof T C 5: 123,104,530 probably null Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Serpina3f T C 12: 104,219,481 I315T possibly damaging Het
Slc1a6 T A 10: 78,812,881 S479T possibly damaging Het
Tmcc1 T C 6: 116,042,913 D166G probably damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Zfp217 T C 2: 170,112,518 D1038G probably damaging Het
Zfp709 A G 8: 71,890,553 R609G probably damaging Het
Zfp986 A T 4: 145,892,520 probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Zfp729a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Zfp729a APN 13 67619321 missense probably benign 0.01
IGL01956:Zfp729a APN 13 67621686 missense probably damaging 1.00
IGL02852:Zfp729a APN 13 67619951 missense possibly damaging 0.69
IGL03130:Zfp729a APN 13 67619642 intron probably null
adalet UTSW 13 67619507 missense probably benign 0.00
R0329:Zfp729a UTSW 13 67620354 missense probably damaging 1.00
R0330:Zfp729a UTSW 13 67620354 missense probably damaging 1.00
R0383:Zfp729a UTSW 13 67621673 missense possibly damaging 0.83
R0545:Zfp729a UTSW 13 67620226 missense probably benign 0.09
R1013:Zfp729a UTSW 13 67619507 missense probably benign 0.00
R1079:Zfp729a UTSW 13 67619675 missense possibly damaging 0.71
R1255:Zfp729a UTSW 13 67621846 missense probably benign 0.03
R1525:Zfp729a UTSW 13 67619321 missense probably benign 0.01
R1768:Zfp729a UTSW 13 67619251 missense probably benign 0.00
R1926:Zfp729a UTSW 13 67619557 missense probably benign 0.29
R2043:Zfp729a UTSW 13 67621172 missense probably damaging 1.00
R2118:Zfp729a UTSW 13 67621494 intron probably null
R3820:Zfp729a UTSW 13 67621319 missense probably damaging 1.00
R3830:Zfp729a UTSW 13 67619878 missense probably damaging 1.00
R4134:Zfp729a UTSW 13 67619806 missense probably damaging 1.00
R4135:Zfp729a UTSW 13 67619806 missense probably damaging 1.00
R4670:Zfp729a UTSW 13 67621415 nonsense probably null
R4793:Zfp729a UTSW 13 67620427 missense probably damaging 1.00
R5009:Zfp729a UTSW 13 67620246 missense probably benign 0.01
R5125:Zfp729a UTSW 13 67637645 critical splice donor site probably null
R5178:Zfp729a UTSW 13 67637645 critical splice donor site probably null
R5438:Zfp729a UTSW 13 67619586 missense possibly damaging 0.94
R6540:Zfp729a UTSW 13 67619648 missense possibly damaging 0.81
R6731:Zfp729a UTSW 13 67620146 missense probably benign 0.09
R6987:Zfp729a UTSW 13 67619939 nonsense probably null
R7001:Zfp729a UTSW 13 67620349 missense probably benign 0.31
R7626:Zfp729a UTSW 13 67620318 nonsense probably null
R7706:Zfp729a UTSW 13 67623493 missense possibly damaging 0.72
R7855:Zfp729a UTSW 13 67619948 missense possibly damaging 0.94
R7864:Zfp729a UTSW 13 67621450 missense probably benign 0.34
R7938:Zfp729a UTSW 13 67619948 missense possibly damaging 0.94
R7947:Zfp729a UTSW 13 67621450 missense probably benign 0.34
R8061:Zfp729a UTSW 13 67620089 missense probably benign
X0010:Zfp729a UTSW 13 67621782 missense probably damaging 0.98
Z1177:Zfp729a UTSW 13 67620231 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CACATTCTTCACACTTGTAGGGTT -3'
(R):5'- GTGACGTATGTGGCCAGGC -3'

Sequencing Primer
(F):5'- TGAAACATGGAAGTCCTTGCC -3'
(R):5'- ATGTGGCCAGGCATTCCATG -3'
Posted On2015-04-17