Incidental Mutation 'R3926:Asb14'
ID308299
Institutional Source Beutler Lab
Gene Symbol Asb14
Ensembl Gene ENSMUSG00000021898
Gene Nameankyrin repeat and SOCS box-containing 14
Synonyms
MMRRC Submission 040821-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R3926 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location26894557-26915258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26897738 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 48 (I48T)
Ref Sequence ENSEMBL: ENSMUSP00000130428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090337] [ENSMUST00000165929] [ENSMUST00000167929]
Predicted Effect probably benign
Transcript: ENSMUST00000090337
AA Change: I47T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000087810
Gene: ENSMUSG00000021898
AA Change: I47T

DomainStartEndE-ValueType
ANK 109 138 9.62e2 SMART
ANK 144 173 2.34e-1 SMART
ANK 177 206 1.7e-3 SMART
ANK 210 239 1.7e-3 SMART
ANK 243 272 2.66e-5 SMART
ANK 276 305 4.75e-2 SMART
ANK 309 337 4.31e2 SMART
ANK 341 370 5.24e-4 SMART
ANK 383 412 3.6e-2 SMART
ANK 413 442 5.45e-2 SMART
ANK 450 477 1.9e3 SMART
SOCS_box 559 601 1.8e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165929
AA Change: I47T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129753
Gene: ENSMUSG00000021898
AA Change: I47T

DomainStartEndE-ValueType
ANK 109 138 9.62e2 SMART
ANK 144 173 2.34e-1 SMART
ANK 177 206 1.7e-3 SMART
ANK 210 239 1.7e-3 SMART
ANK 243 272 2.66e-5 SMART
ANK 276 305 4.75e-2 SMART
ANK 309 337 4.31e2 SMART
ANK 341 370 5.24e-4 SMART
ANK 383 412 3.6e-2 SMART
ANK 413 442 5.45e-2 SMART
ANK 450 477 1.9e3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167365
Predicted Effect possibly damaging
Transcript: ENSMUST00000167929
AA Change: I48T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1187 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat and SOCS box-containing (ASB) family of proteins. They contain ankyrin repeat sequence and a SOCS box domain. The SOCS box serves to couple suppressor of cytokine signalling (SOCS) proteins and their binding partners with the elongin B and C complex, possibly targeting them for degradation. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Ahnak G A 19: 9,006,328 D1659N probably benign Het
Arfgap2 C T 2: 91,274,805 R405W probably damaging Het
Astn1 A T 1: 158,579,657 I559F possibly damaging Het
Atg7 C T 6: 114,673,678 T83M possibly damaging Het
Bco1 T C 8: 117,127,472 S379P probably benign Het
Bst1 T C 5: 43,840,454 V265A possibly damaging Het
Car11 T C 7: 45,700,491 F45L probably benign Het
Cdkl2 T C 5: 92,033,139 I214V possibly damaging Het
Cluap1 T A 16: 3,911,534 S141T probably damaging Het
Col11a1 C T 3: 114,090,124 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Corin T G 5: 72,372,130 D294A probably damaging Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx41 A G 13: 55,531,270 L559P probably damaging Het
Ddx59 T A 1: 136,416,744 V51D probably benign Het
Dennd1b A G 1: 139,143,959 N397D probably benign Het
Evc2 T A 5: 37,383,230 L590Q probably damaging Het
Fhl5 A T 4: 25,214,790 probably benign Het
Flg2 A G 3: 93,203,215 Y850C unknown Het
Gal3st2b G T 1: 93,940,790 V246L probably benign Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Jam3 A T 9: 27,106,405 I29K possibly damaging Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Lims2 A G 18: 31,957,943 S327G probably benign Het
Lynx1 A G 15: 74,751,356 Y76H probably damaging Het
Mycbp2 G A 14: 103,204,500 P1943L probably damaging Het
Myo3a A G 2: 22,565,041 D86G probably damaging Het
Nkx3-2 T A 5: 41,761,880 Q255L probably damaging Het
Notch3 C T 17: 32,153,557 R641H possibly damaging Het
Nr2c2 T A 6: 92,160,401 M431K probably damaging Het
Ogfod3 T C 11: 121,183,429 T265A probably damaging Het
Pcdh9 G T 14: 93,886,810 Y641* probably null Het
Pcdha9 T A 18: 36,999,412 D511E probably damaging Het
Pcdhgb8 A G 18: 37,762,390 Y171C probably damaging Het
Pcnx T C 12: 81,958,731 C1075R probably damaging Het
Pik3c3 C A 18: 30,311,329 probably benign Het
Pkhd1 T C 1: 20,550,873 T854A probably benign Het
Pycr1 T C 11: 120,642,135 T100A probably benign Het
Rhof T C 5: 123,104,530 probably null Het
Scn9a T A 2: 66,526,873 D1028V possibly damaging Het
Serpina3f T C 12: 104,219,481 I315T possibly damaging Het
Slc1a6 T A 10: 78,812,881 S479T possibly damaging Het
Tmcc1 T C 6: 116,042,913 D166G probably damaging Het
Trav3-3 A G 14: 53,666,371 K49E probably benign Het
Usp28 T C 9: 49,030,923 probably null Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Zfp217 T C 2: 170,112,518 D1038G probably damaging Het
Zfp709 A G 8: 71,890,553 R609G probably damaging Het
Zfp729a T A 13: 67,620,191 K640* probably null Het
Zfp986 A T 4: 145,892,520 probably benign Het
Zkscan6 A T 11: 65,828,225 H357L probably benign Het
Other mutations in Asb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Asb14 APN 14 26912041 missense probably benign 0.01
IGL01412:Asb14 APN 14 26915065 missense probably damaging 1.00
IGL02805:Asb14 APN 14 26901187 missense possibly damaging 0.89
IGL03100:Asb14 APN 14 26903372 missense probably benign 0.03
R1208:Asb14 UTSW 14 26900418 splice site probably benign
R1707:Asb14 UTSW 14 26901122 missense probably benign 0.14
R1828:Asb14 UTSW 14 26911840 missense possibly damaging 0.67
R3056:Asb14 UTSW 14 26914189 missense possibly damaging 0.62
R4991:Asb14 UTSW 14 26915058 missense probably damaging 1.00
R4996:Asb14 UTSW 14 26912116 missense possibly damaging 0.94
R5306:Asb14 UTSW 14 26911909 missense probably damaging 1.00
R5524:Asb14 UTSW 14 26900451 missense possibly damaging 0.94
R7032:Asb14 UTSW 14 26903455 missense probably benign 0.06
R7202:Asb14 UTSW 14 26900437 missense probably benign 0.13
R7259:Asb14 UTSW 14 26903455 missense probably benign 0.06
R7468:Asb14 UTSW 14 26900848 missense probably benign 0.10
R7733:Asb14 UTSW 14 26912352 missense probably benign 0.00
R7765:Asb14 UTSW 14 26897761 missense probably benign 0.03
R8162:Asb14 UTSW 14 26911988 missense probably benign 0.01
R8305:Asb14 UTSW 14 26912097 missense probably benign 0.01
Z1088:Asb14 UTSW 14 26903348 missense probably benign 0.02
Z1177:Asb14 UTSW 14 26912299 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGTTTCCAGTCTTCTAAACGC -3'
(R):5'- GGGCATCATATCTTATACACACTTCAG -3'

Sequencing Primer
(F):5'- CGCCATCTGTATTTTTAAGCAGTTG -3'
(R):5'- GTTATCCTCTGGAAAACGCAGCTC -3'
Posted On2015-04-17