Incidental Mutation 'R3927:Pacsin3'
ID 308312
Institutional Source Beutler Lab
Gene Symbol Pacsin3
Ensembl Gene ENSMUSG00000027257
Gene Name protein kinase C and casein kinase substrate in neurons 3
Synonyms 6330413E15Rik, 4921507A02Rik
MMRRC Submission 040822-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3927 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 91086299-91095024 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 91093286 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028691] [ENSMUST00000028694] [ENSMUST00000059566] [ENSMUST00000080008] [ENSMUST00000111349] [ENSMUST00000168916] [ENSMUST00000144394] [ENSMUST00000138470] [ENSMUST00000156919] [ENSMUST00000131711] [ENSMUST00000134699] [ENSMUST00000154959]
AlphaFold Q99JB8
Predicted Effect probably benign
Transcript: ENSMUST00000028691
SMART Domains Protein: ENSMUSP00000028691
Gene: ENSMUSG00000027255

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 227 246 N/A INTRINSIC
coiled coil region 254 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Blast:ArfGap 370 434 6e-32 BLAST
low complexity region 468 476 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000028694
SMART Domains Protein: ENSMUSP00000028694
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000059566
SMART Domains Protein: ENSMUSP00000054391
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080008
SMART Domains Protein: ENSMUSP00000078920
Gene: ENSMUSG00000027255

DomainStartEndE-ValueType
ArfGap 11 125 1.46e-44 SMART
low complexity region 213 232 N/A INTRINSIC
coiled coil region 240 307 N/A INTRINSIC
low complexity region 309 321 N/A INTRINSIC
internal_repeat_1 333 376 9.77e-5 PROSPERO
low complexity region 454 462 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111349
SMART Domains Protein: ENSMUSP00000106981
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128296
Predicted Effect probably benign
Transcript: ENSMUST00000128684
SMART Domains Protein: ENSMUSP00000118915
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
PDB:3SYV|H 2 61 3e-37 PDB
low complexity region 62 74 N/A INTRINSIC
SCOP:d1k4us_ 86 112 6e-7 SMART
PDB:2X3X|E 88 112 7e-7 PDB
Blast:SH3 91 112 1e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000168916
SMART Domains Protein: ENSMUSP00000129175
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
low complexity region 337 349 N/A INTRINSIC
SH3 366 423 1.03e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150753
Predicted Effect probably benign
Transcript: ENSMUST00000144394
SMART Domains Protein: ENSMUSP00000121297
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 95 4.88e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138470
SMART Domains Protein: ENSMUSP00000117230
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156919
SMART Domains Protein: ENSMUSP00000122779
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131711
SMART Domains Protein: ENSMUSP00000117214
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134699
SMART Domains Protein: ENSMUSP00000115046
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
FCH 14 102 2.05e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154959
SMART Domains Protein: ENSMUSP00000122769
Gene: ENSMUSG00000027257

DomainStartEndE-ValueType
Pfam:FCH 14 64 2.3e-15 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protein kinase C and casein kinase substrate in neurons family. The encoded protein is involved in linking the actin cytoskeleton with vesicle formation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A G 2: 103,538,563 (GRCm39) probably null Het
Alpk1 T C 3: 127,471,365 (GRCm39) H1039R probably damaging Het
Avpr1a A G 10: 122,285,616 (GRCm39) S303G probably benign Het
Axdnd1 A G 1: 156,246,840 (GRCm39) L79S probably damaging Het
Baz1a A G 12: 54,967,928 (GRCm39) I667T possibly damaging Het
Bend5 A G 4: 111,305,802 (GRCm39) Y282C possibly damaging Het
Clstn3 T C 6: 124,428,327 (GRCm39) D438G probably damaging Het
Cog3 A G 14: 75,980,998 (GRCm39) probably benign Het
Cyp2j6 T C 4: 96,441,525 (GRCm39) N55S probably benign Het
Eif4b G A 15: 101,992,745 (GRCm39) G101R probably damaging Het
Epha2 T C 4: 141,033,861 (GRCm39) L40P probably damaging Het
Fig4 A G 10: 41,139,135 (GRCm39) V356A probably benign Het
Hal T C 10: 93,349,888 (GRCm39) probably benign Het
Helz A G 11: 107,576,118 (GRCm39) Y1770C unknown Het
Meis3 A G 7: 15,911,419 (GRCm39) T39A probably benign Het
Nod1 G T 6: 54,921,902 (GRCm39) R139S probably benign Het
Or6n2 A T 1: 173,896,878 (GRCm39) N5Y probably damaging Het
Plekhh1 T A 12: 79,100,422 (GRCm39) I130N probably damaging Het
Plxna2 G A 1: 194,428,465 (GRCm39) E512K probably benign Het
Ppp1r9a A G 6: 5,057,531 (GRCm39) I215M probably damaging Het
Ryr3 C G 2: 112,506,218 (GRCm39) R3443P probably damaging Het
Sap130 A T 18: 31,807,435 (GRCm39) H414L possibly damaging Het
Slc33a1 A G 3: 63,871,145 (GRCm39) I156T probably benign Het
Slc37a2 G A 9: 37,146,803 (GRCm39) T338M probably damaging Het
Spinkl T A 18: 44,302,230 (GRCm39) probably null Het
Tmc5 T A 7: 118,251,878 (GRCm39) L657* probably null Het
Tmem217 A G 17: 29,745,677 (GRCm39) S18P probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,465,042 (GRCm39) probably benign Het
Tubb4a A G 17: 57,387,967 (GRCm39) V353A probably benign Het
Ube3b T C 5: 114,553,741 (GRCm39) F974L probably benign Het
Ubqln5 A G 7: 103,777,678 (GRCm39) L382P probably damaging Het
Ufsp2 T A 8: 46,436,723 (GRCm39) probably null Het
Unkl C T 17: 25,448,303 (GRCm39) T66I probably damaging Het
Xrn2 T A 2: 146,880,109 (GRCm39) N477K probably benign Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zzef1 T C 11: 72,749,208 (GRCm39) S899P probably damaging Het
Zzz3 T C 3: 152,161,499 (GRCm39) Y298H probably damaging Het
Other mutations in Pacsin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Pacsin3 APN 2 91,094,121 (GRCm39) missense probably benign
IGL03071:Pacsin3 APN 2 91,090,837 (GRCm39) missense probably damaging 0.99
IGL03149:Pacsin3 APN 2 91,091,852 (GRCm39) splice site probably benign
pacifica UTSW 2 91,093,286 (GRCm39) splice site probably null
R1179:Pacsin3 UTSW 2 91,094,205 (GRCm39) missense probably damaging 1.00
R1765:Pacsin3 UTSW 2 91,093,460 (GRCm39) missense possibly damaging 0.94
R4472:Pacsin3 UTSW 2 91,093,288 (GRCm39) splice site probably null
R5699:Pacsin3 UTSW 2 91,093,126 (GRCm39) missense probably damaging 1.00
R5721:Pacsin3 UTSW 2 91,094,580 (GRCm39) missense probably damaging 1.00
R5732:Pacsin3 UTSW 2 91,090,605 (GRCm39) missense probably damaging 1.00
R6213:Pacsin3 UTSW 2 91,090,779 (GRCm39) missense probably damaging 1.00
R6449:Pacsin3 UTSW 2 91,090,514 (GRCm39) critical splice acceptor site probably null
R6541:Pacsin3 UTSW 2 91,093,129 (GRCm39) missense probably damaging 1.00
R6834:Pacsin3 UTSW 2 91,093,180 (GRCm39) missense probably damaging 1.00
R8513:Pacsin3 UTSW 2 91,093,150 (GRCm39) missense probably benign 0.00
R9060:Pacsin3 UTSW 2 91,091,557 (GRCm39) missense probably benign 0.00
R9772:Pacsin3 UTSW 2 91,093,138 (GRCm39) missense probably damaging 1.00
R9792:Pacsin3 UTSW 2 91,094,160 (GRCm39) missense probably benign
R9793:Pacsin3 UTSW 2 91,094,160 (GRCm39) missense probably benign
R9795:Pacsin3 UTSW 2 91,094,160 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGCAGTCTGTCCTCACTG -3'
(R):5'- CAGCGCAGATCCTCTTCATC -3'

Sequencing Primer
(F):5'- TTCTCTCTCACCCAGATGAAAAC -3'
(R):5'- TCACTGGCAGCCTCAATG -3'
Posted On 2015-04-17