Incidental Mutation 'R3927:Abtb2'
ID 308313
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Name ankyrin repeat and BTB domain containing 2
Synonyms BPOZ-2
MMRRC Submission 040822-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3927 (G1)
Quality Score 133
Status Validated
Chromosome 2
Chromosomal Location 103396655-103548768 bp(+) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to G at 103538563 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212]
AlphaFold Q7TQI7
Predicted Effect probably null
Transcript: ENSMUST00000076212
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 T C 3: 127,471,365 (GRCm39) H1039R probably damaging Het
Avpr1a A G 10: 122,285,616 (GRCm39) S303G probably benign Het
Axdnd1 A G 1: 156,246,840 (GRCm39) L79S probably damaging Het
Baz1a A G 12: 54,967,928 (GRCm39) I667T possibly damaging Het
Bend5 A G 4: 111,305,802 (GRCm39) Y282C possibly damaging Het
Clstn3 T C 6: 124,428,327 (GRCm39) D438G probably damaging Het
Cog3 A G 14: 75,980,998 (GRCm39) probably benign Het
Cyp2j6 T C 4: 96,441,525 (GRCm39) N55S probably benign Het
Eif4b G A 15: 101,992,745 (GRCm39) G101R probably damaging Het
Epha2 T C 4: 141,033,861 (GRCm39) L40P probably damaging Het
Fig4 A G 10: 41,139,135 (GRCm39) V356A probably benign Het
Hal T C 10: 93,349,888 (GRCm39) probably benign Het
Helz A G 11: 107,576,118 (GRCm39) Y1770C unknown Het
Meis3 A G 7: 15,911,419 (GRCm39) T39A probably benign Het
Nod1 G T 6: 54,921,902 (GRCm39) R139S probably benign Het
Or6n2 A T 1: 173,896,878 (GRCm39) N5Y probably damaging Het
Pacsin3 C T 2: 91,093,286 (GRCm39) probably null Het
Plekhh1 T A 12: 79,100,422 (GRCm39) I130N probably damaging Het
Plxna2 G A 1: 194,428,465 (GRCm39) E512K probably benign Het
Ppp1r9a A G 6: 5,057,531 (GRCm39) I215M probably damaging Het
Ryr3 C G 2: 112,506,218 (GRCm39) R3443P probably damaging Het
Sap130 A T 18: 31,807,435 (GRCm39) H414L possibly damaging Het
Slc33a1 A G 3: 63,871,145 (GRCm39) I156T probably benign Het
Slc37a2 G A 9: 37,146,803 (GRCm39) T338M probably damaging Het
Spinkl T A 18: 44,302,230 (GRCm39) probably null Het
Tmc5 T A 7: 118,251,878 (GRCm39) L657* probably null Het
Tmem217 A G 17: 29,745,677 (GRCm39) S18P probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,465,042 (GRCm39) probably benign Het
Tubb4a A G 17: 57,387,967 (GRCm39) V353A probably benign Het
Ube3b T C 5: 114,553,741 (GRCm39) F974L probably benign Het
Ubqln5 A G 7: 103,777,678 (GRCm39) L382P probably damaging Het
Ufsp2 T A 8: 46,436,723 (GRCm39) probably null Het
Unkl C T 17: 25,448,303 (GRCm39) T66I probably damaging Het
Xrn2 T A 2: 146,880,109 (GRCm39) N477K probably benign Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zzef1 T C 11: 72,749,208 (GRCm39) S899P probably damaging Het
Zzz3 T C 3: 152,161,499 (GRCm39) Y298H probably damaging Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103,535,463 (GRCm39) missense probably benign 0.00
IGL02605:Abtb2 APN 2 103,547,602 (GRCm39) missense probably benign
IGL03161:Abtb2 APN 2 103,397,799 (GRCm39) missense probably benign 0.02
PIT4504001:Abtb2 UTSW 2 103,547,537 (GRCm39) nonsense probably null
R0147:Abtb2 UTSW 2 103,397,480 (GRCm39) missense probably benign 0.04
R1052:Abtb2 UTSW 2 103,535,417 (GRCm39) missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103,539,765 (GRCm39) missense probably benign 0.00
R1518:Abtb2 UTSW 2 103,539,629 (GRCm39) missense probably benign 0.03
R1650:Abtb2 UTSW 2 103,532,747 (GRCm39) missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103,397,369 (GRCm39) missense probably benign 0.00
R2054:Abtb2 UTSW 2 103,535,462 (GRCm39) missense probably benign 0.41
R2101:Abtb2 UTSW 2 103,397,207 (GRCm39) missense probably benign 0.05
R2363:Abtb2 UTSW 2 103,397,528 (GRCm39) missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103,397,577 (GRCm39) missense probably benign 0.43
R4351:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103,547,644 (GRCm39) missense probably benign 0.35
R4814:Abtb2 UTSW 2 103,547,632 (GRCm39) missense probably benign 0.08
R4831:Abtb2 UTSW 2 103,513,820 (GRCm39) missense probably benign 0.06
R4900:Abtb2 UTSW 2 103,397,349 (GRCm39) missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103,397,408 (GRCm39) missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103,539,623 (GRCm39) critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103,532,655 (GRCm39) missense probably benign 0.00
R6298:Abtb2 UTSW 2 103,539,833 (GRCm39) missense probably benign 0.10
R6383:Abtb2 UTSW 2 103,397,721 (GRCm39) missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103,539,770 (GRCm39) nonsense probably null
R7000:Abtb2 UTSW 2 103,542,787 (GRCm39) missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103,545,860 (GRCm39) missense probably benign 0.20
R7176:Abtb2 UTSW 2 103,539,720 (GRCm39) missense probably benign 0.00
R7189:Abtb2 UTSW 2 103,397,861 (GRCm39) missense probably benign 0.00
R7199:Abtb2 UTSW 2 103,397,565 (GRCm39) missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103,532,769 (GRCm39) splice site probably null
R7347:Abtb2 UTSW 2 103,397,757 (GRCm39) missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103,397,292 (GRCm39) missense probably benign 0.00
R7629:Abtb2 UTSW 2 103,513,838 (GRCm39) critical splice donor site probably null
R7862:Abtb2 UTSW 2 103,532,626 (GRCm39) missense probably damaging 1.00
R8200:Abtb2 UTSW 2 103,531,162 (GRCm39) missense probably benign 0.02
R8682:Abtb2 UTSW 2 103,397,720 (GRCm39) missense probably benign 0.36
R8700:Abtb2 UTSW 2 103,397,289 (GRCm39) missense probably damaging 0.99
R9164:Abtb2 UTSW 2 103,541,829 (GRCm39) missense possibly damaging 0.50
R9196:Abtb2 UTSW 2 103,513,647 (GRCm39) missense possibly damaging 0.71
R9254:Abtb2 UTSW 2 103,541,580 (GRCm39) missense probably benign 0.00
R9258:Abtb2 UTSW 2 103,546,410 (GRCm39) missense probably null 0.99
R9343:Abtb2 UTSW 2 103,547,505 (GRCm39) missense probably benign
R9427:Abtb2 UTSW 2 103,531,244 (GRCm39) missense probably damaging 1.00
R9675:Abtb2 UTSW 2 103,538,532 (GRCm39) missense probably benign
Z1176:Abtb2 UTSW 2 103,538,517 (GRCm39) nonsense probably null
Z1177:Abtb2 UTSW 2 103,541,541 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGATCTCATGAACCCTGG -3'
(R):5'- CAGCGTGTCAGAAGTCAGAG -3'

Sequencing Primer
(F):5'- AGATCTCATGAACCCTGGTACTTC -3'
(R):5'- GAAGTCAGAGCTCATCCAGTGTCTC -3'
Posted On 2015-04-17