Incidental Mutation 'R3927:Abtb2'
ID 308313
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Name ankyrin repeat and BTB (POZ) domain containing 2
Synonyms
MMRRC Submission 040822-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3927 (G1)
Quality Score 133
Status Validated
Chromosome 2
Chromosomal Location 103566310-103718423 bp(+) (GRCm38)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) A to G at 103708218 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212]
AlphaFold Q7TQI7
Predicted Effect probably null
Transcript: ENSMUST00000076212
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk1 T C 3: 127,677,716 H1039R probably damaging Het
Avpr1a A G 10: 122,449,711 S303G probably benign Het
Axdnd1 A G 1: 156,419,270 L79S probably damaging Het
Baz1a A G 12: 54,921,143 I667T possibly damaging Het
Bend5 A G 4: 111,448,605 Y282C possibly damaging Het
Clstn3 T C 6: 124,451,368 D438G probably damaging Het
Cog3 A G 14: 75,743,558 probably benign Het
Cyp2j6 T C 4: 96,553,288 N55S probably benign Het
Eif4b G A 15: 102,084,310 G101R probably damaging Het
Epha2 T C 4: 141,306,550 L40P probably damaging Het
Fig4 A G 10: 41,263,139 V356A probably benign Het
Hal T C 10: 93,514,026 probably benign Het
Helz A G 11: 107,685,292 Y1770C unknown Het
Meis3 A G 7: 16,177,494 T39A probably benign Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Olfr430 A T 1: 174,069,312 N5Y probably damaging Het
Pacsin3 C T 2: 91,262,941 probably null Het
Plekhh1 T A 12: 79,053,648 I130N probably damaging Het
Plxna2 G A 1: 194,746,157 E512K probably benign Het
Ppp1r9a A G 6: 5,057,531 I215M probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Sap130 A T 18: 31,674,382 H414L possibly damaging Het
Slc33a1 A G 3: 63,963,724 I156T probably benign Het
Slc37a2 G A 9: 37,235,507 T338M probably damaging Het
Spinkl T A 18: 44,169,163 probably null Het
Tmc5 T A 7: 118,652,655 L657* probably null Het
Tmem217 A G 17: 29,526,703 S18P probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Tubb4a A G 17: 57,080,967 V353A probably benign Het
Ube3b T C 5: 114,415,680 F974L probably benign Het
Ubqln5 A G 7: 104,128,471 L382P probably damaging Het
Ufsp2 T A 8: 45,983,686 probably null Het
Unkl C T 17: 25,229,329 T66I probably damaging Het
Xrn2 T A 2: 147,038,189 N477K probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zzef1 T C 11: 72,858,382 S899P probably damaging Het
Zzz3 T C 3: 152,455,862 Y298H probably damaging Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103705118 missense probably benign 0.00
IGL02605:Abtb2 APN 2 103717257 missense probably benign
IGL03161:Abtb2 APN 2 103567454 missense probably benign 0.02
PIT4504001:Abtb2 UTSW 2 103717192 nonsense probably null
R0147:Abtb2 UTSW 2 103567135 missense probably benign 0.04
R1052:Abtb2 UTSW 2 103705072 missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103709420 missense probably benign 0.00
R1518:Abtb2 UTSW 2 103709284 missense probably benign 0.03
R1650:Abtb2 UTSW 2 103702402 missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103567024 missense probably benign 0.00
R2054:Abtb2 UTSW 2 103705117 missense probably benign 0.41
R2101:Abtb2 UTSW 2 103566862 missense probably benign 0.05
R2363:Abtb2 UTSW 2 103567183 missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103567232 missense probably benign 0.43
R4351:Abtb2 UTSW 2 103683393 missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103683393 missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103717299 missense probably benign 0.35
R4814:Abtb2 UTSW 2 103717287 missense probably benign 0.08
R4831:Abtb2 UTSW 2 103683475 missense probably benign 0.06
R4900:Abtb2 UTSW 2 103567004 missense possibly damaging 0.62
R5038:Abtb2 UTSW 2 103567063 missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103709278 critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103702310 missense probably benign 0.00
R6298:Abtb2 UTSW 2 103709488 missense probably benign 0.10
R6383:Abtb2 UTSW 2 103567376 missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103709425 nonsense probably null
R7000:Abtb2 UTSW 2 103712442 missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103715515 missense probably benign 0.20
R7176:Abtb2 UTSW 2 103709375 missense probably benign 0.00
R7189:Abtb2 UTSW 2 103567516 missense probably benign 0.00
R7199:Abtb2 UTSW 2 103567220 missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103702424 splice site probably null
R7347:Abtb2 UTSW 2 103567412 missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103566947 missense probably benign 0.00
R7629:Abtb2 UTSW 2 103683493 critical splice donor site probably null
R7862:Abtb2 UTSW 2 103702281 missense probably damaging 1.00
R8200:Abtb2 UTSW 2 103700817 missense probably benign 0.02
R8682:Abtb2 UTSW 2 103567375 missense probably benign 0.36
R8700:Abtb2 UTSW 2 103566944 missense probably damaging 0.99
R9164:Abtb2 UTSW 2 103711484 missense possibly damaging 0.50
R9196:Abtb2 UTSW 2 103683302 missense possibly damaging 0.71
R9254:Abtb2 UTSW 2 103711235 missense probably benign 0.00
R9258:Abtb2 UTSW 2 103716065 missense probably null 0.99
R9343:Abtb2 UTSW 2 103717160 missense probably benign
R9427:Abtb2 UTSW 2 103700899 missense probably damaging 1.00
R9675:Abtb2 UTSW 2 103708187 missense probably benign
Z1176:Abtb2 UTSW 2 103708172 nonsense probably null
Z1177:Abtb2 UTSW 2 103711196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGATCTCATGAACCCTGG -3'
(R):5'- CAGCGTGTCAGAAGTCAGAG -3'

Sequencing Primer
(F):5'- AGATCTCATGAACCCTGGTACTTC -3'
(R):5'- GAAGTCAGAGCTCATCCAGTGTCTC -3'
Posted On 2015-04-17