Mutagenetix > Incidental Mutation

Incidental Mutation 'R3927:Abtb2'

308313

Institutional Source

Beutler Lab

Gene Symbol

Abtb2

Ensembl Gene

ENSMUSG00000032724

Gene Name

ankyrin repeat and BTB (POZ) domain containing 2

Synonyms

MMRRC Submission

040822-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3927 (G1)

Quality Score

133

Status

Validated

Chromosome

Chromosomal Location

103566310-103718423 bp(+) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

A to G at 103708218 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000075566 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076212]

AlphaFold

Q7TQI7

Predicted Effect

probably null
Transcript: ENSMUST00000076212

SMART Domains

Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724

Domain	Start	End	E-Value	Type
low complexity region	29	48	N/A	INTRINSIC
low complexity region	122	143	N/A	INTRINSIC
Blast:H2A	186	301	2e-38	BLAST
low complexity region	366	376	N/A	INTRINSIC
ANK	521	550	4.78e-7	SMART
ANK	567	596	6.26e-2	SMART
ANK	606	635	3.65e-3	SMART
ANK	649	678	5.52e2	SMART
ANK	715	746	1.84e3	SMART
BTB	844	946	9.15e-24	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

95% (40/42)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk1	T	C	3: 127,677,716	H1039R	probably damaging	Het
Avpr1a	A	G	10: 122,449,711	S303G	probably benign	Het
Axdnd1	A	G	1: 156,419,270	L79S	probably damaging	Het
Baz1a	A	G	12: 54,921,143	I667T	possibly damaging	Het
Bend5	A	G	4: 111,448,605	Y282C	possibly damaging	Het
Clstn3	T	C	6: 124,451,368	D438G	probably damaging	Het
Cog3	A	G	14: 75,743,558		probably benign	Het
Cyp2j6	T	C	4: 96,553,288	N55S	probably benign	Het
Eif4b	G	A	15: 102,084,310	G101R	probably damaging	Het
Epha2	T	C	4: 141,306,550	L40P	probably damaging	Het
Fig4	A	G	10: 41,263,139	V356A	probably benign	Het
Hal	T	C	10: 93,514,026		probably benign	Het
Helz	A	G	11: 107,685,292	Y1770C	unknown	Het
Meis3	A	G	7: 16,177,494	T39A	probably benign	Het
Nod1	G	T	6: 54,944,917	R139S	probably benign	Het
Olfr430	A	T	1: 174,069,312	N5Y	probably damaging	Het
Pacsin3	C	T	2: 91,262,941		probably null	Het
Plekhh1	T	A	12: 79,053,648	I130N	probably damaging	Het
Plxna2	G	A	1: 194,746,157	E512K	probably benign	Het
Ppp1r9a	A	G	6: 5,057,531	I215M	probably damaging	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Sap130	A	T	18: 31,674,382	H414L	possibly damaging	Het
Slc33a1	A	G	3: 63,963,724	I156T	probably benign	Het
Slc37a2	G	A	9: 37,235,507	T338M	probably damaging	Het
Spinkl	T	A	18: 44,169,163		probably null	Het
Tmc5	T	A	7: 118,652,655	L657*	probably null	Het
Tmem217	A	G	17: 29,526,703	S18P	probably damaging	Het
Trim43a	GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT	GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT	9: 88,582,989		probably benign	Het
Tubb4a	A	G	17: 57,080,967	V353A	probably benign	Het
Ube3b	T	C	5: 114,415,680	F974L	probably benign	Het
Ubqln5	A	G	7: 104,128,471	L382P	probably damaging	Het
Ufsp2	T	A	8: 45,983,686		probably null	Het
Unkl	C	T	17: 25,229,329	T66I	probably damaging	Het
Xrn2	T	A	2: 147,038,189	N477K	probably benign	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zzef1	T	C	11: 72,858,382	S899P	probably damaging	Het
Zzz3	T	C	3: 152,455,862	Y298H	probably damaging	Het

Other mutations in Abtb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Abtb2	APN	2	103705118	missense	probably benign	0.00
IGL02605:Abtb2	APN	2	103717257	missense	probably benign
IGL03161:Abtb2	APN	2	103567454	missense	probably benign	0.02
PIT4504001:Abtb2	UTSW	2	103717192	nonsense	probably null
R0147:Abtb2	UTSW	2	103567135	missense	probably benign	0.04
R1052:Abtb2	UTSW	2	103705072	missense	possibly damaging	0.46
R1419:Abtb2	UTSW	2	103709420	missense	probably benign	0.00
R1518:Abtb2	UTSW	2	103709284	missense	probably benign	0.03
R1650:Abtb2	UTSW	2	103702402	missense	probably damaging	1.00
R1795:Abtb2	UTSW	2	103567024	missense	probably benign	0.00
R2054:Abtb2	UTSW	2	103705117	missense	probably benign	0.41
R2101:Abtb2	UTSW	2	103566862	missense	probably benign	0.05
R2363:Abtb2	UTSW	2	103567183	missense	probably damaging	1.00
R3440:Abtb2	UTSW	2	103567232	missense	probably benign	0.43
R4351:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4352:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4782:Abtb2	UTSW	2	103717299	missense	probably benign	0.35
R4814:Abtb2	UTSW	2	103717287	missense	probably benign	0.08
R4831:Abtb2	UTSW	2	103683475	missense	probably benign	0.06
R4900:Abtb2	UTSW	2	103567004	missense	possibly damaging	0.62
R5038:Abtb2	UTSW	2	103567063	missense	probably damaging	0.99
R5513:Abtb2	UTSW	2	103709278	critical splice acceptor site	probably null
R6119:Abtb2	UTSW	2	103702310	missense	probably benign	0.00
R6298:Abtb2	UTSW	2	103709488	missense	probably benign	0.10
R6383:Abtb2	UTSW	2	103567376	missense	probably damaging	0.98
R6860:Abtb2	UTSW	2	103709425	nonsense	probably null
R7000:Abtb2	UTSW	2	103712442	missense	possibly damaging	0.85
R7109:Abtb2	UTSW	2	103715515	missense	probably benign	0.20
R7176:Abtb2	UTSW	2	103709375	missense	probably benign	0.00
R7189:Abtb2	UTSW	2	103567516	missense	probably benign	0.00
R7199:Abtb2	UTSW	2	103567220	missense	possibly damaging	0.74
R7299:Abtb2	UTSW	2	103702424	splice site	probably null
R7347:Abtb2	UTSW	2	103567412	missense	probably damaging	1.00
R7469:Abtb2	UTSW	2	103566947	missense	probably benign	0.00
R7629:Abtb2	UTSW	2	103683493	critical splice donor site	probably null
R7862:Abtb2	UTSW	2	103702281	missense	probably damaging	1.00
R8200:Abtb2	UTSW	2	103700817	missense	probably benign	0.02
R8682:Abtb2	UTSW	2	103567375	missense	probably benign	0.36
R8700:Abtb2	UTSW	2	103566944	missense	probably damaging	0.99
R9164:Abtb2	UTSW	2	103711484	missense	possibly damaging	0.50
R9196:Abtb2	UTSW	2	103683302	missense	possibly damaging	0.71
R9254:Abtb2	UTSW	2	103711235	missense	probably benign	0.00
R9258:Abtb2	UTSW	2	103716065	missense	probably null	0.99
R9343:Abtb2	UTSW	2	103717160	missense	probably benign
R9427:Abtb2	UTSW	2	103700899	missense	probably damaging	1.00
R9675:Abtb2	UTSW	2	103708187	missense	probably benign
Z1176:Abtb2	UTSW	2	103708172	nonsense	probably null
Z1177:Abtb2	UTSW	2	103711196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCAGATCTCATGAACCCTGG -3'
(R):5'- CAGCGTGTCAGAAGTCAGAG -3'

Sequencing Primer
(F):5'- AGATCTCATGAACCCTGGTACTTC -3'
(R):5'- GAAGTCAGAGCTCATCCAGTGTCTC -3'

Posted On

2015-04-17