Incidental Mutation 'R3927:Xrn2'
ID 308315
Institutional Source Beutler Lab
Gene Symbol Xrn2
Ensembl Gene ENSMUSG00000027433
Gene Name 5'-3' exoribonuclease 2
Synonyms
MMRRC Submission 040822-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R3927 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 146854916-146919920 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 146880109 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 477 (N477K)
Ref Sequence ENSEMBL: ENSMUSP00000028921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028921]
AlphaFold Q9DBR1
Predicted Effect probably benign
Transcript: ENSMUST00000028921
AA Change: N477K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028921
Gene: ENSMUSG00000027433
AA Change: N477K

DomainStartEndE-ValueType
Pfam:XRN_N 1 254 1.5e-104 PFAM
ZnF_C2HC 262 278 7.99e-1 SMART
low complexity region 415 427 N/A INTRINSIC
PDB:3FQD|A 469 785 8e-75 PDB
low complexity region 913 932 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147057
Meta Mutation Damage Score 0.0830 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 5'-3' exonuclease that promotes transcription termination at cotranscriptional cleavage sites. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A G 2: 103,538,563 (GRCm39) probably null Het
Alpk1 T C 3: 127,471,365 (GRCm39) H1039R probably damaging Het
Avpr1a A G 10: 122,285,616 (GRCm39) S303G probably benign Het
Axdnd1 A G 1: 156,246,840 (GRCm39) L79S probably damaging Het
Baz1a A G 12: 54,967,928 (GRCm39) I667T possibly damaging Het
Bend5 A G 4: 111,305,802 (GRCm39) Y282C possibly damaging Het
Clstn3 T C 6: 124,428,327 (GRCm39) D438G probably damaging Het
Cog3 A G 14: 75,980,998 (GRCm39) probably benign Het
Cyp2j6 T C 4: 96,441,525 (GRCm39) N55S probably benign Het
Eif4b G A 15: 101,992,745 (GRCm39) G101R probably damaging Het
Epha2 T C 4: 141,033,861 (GRCm39) L40P probably damaging Het
Fig4 A G 10: 41,139,135 (GRCm39) V356A probably benign Het
Hal T C 10: 93,349,888 (GRCm39) probably benign Het
Helz A G 11: 107,576,118 (GRCm39) Y1770C unknown Het
Meis3 A G 7: 15,911,419 (GRCm39) T39A probably benign Het
Nod1 G T 6: 54,921,902 (GRCm39) R139S probably benign Het
Or6n2 A T 1: 173,896,878 (GRCm39) N5Y probably damaging Het
Pacsin3 C T 2: 91,093,286 (GRCm39) probably null Het
Plekhh1 T A 12: 79,100,422 (GRCm39) I130N probably damaging Het
Plxna2 G A 1: 194,428,465 (GRCm39) E512K probably benign Het
Ppp1r9a A G 6: 5,057,531 (GRCm39) I215M probably damaging Het
Ryr3 C G 2: 112,506,218 (GRCm39) R3443P probably damaging Het
Sap130 A T 18: 31,807,435 (GRCm39) H414L possibly damaging Het
Slc33a1 A G 3: 63,871,145 (GRCm39) I156T probably benign Het
Slc37a2 G A 9: 37,146,803 (GRCm39) T338M probably damaging Het
Spinkl T A 18: 44,302,230 (GRCm39) probably null Het
Tmc5 T A 7: 118,251,878 (GRCm39) L657* probably null Het
Tmem217 A G 17: 29,745,677 (GRCm39) S18P probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,465,042 (GRCm39) probably benign Het
Tubb4a A G 17: 57,387,967 (GRCm39) V353A probably benign Het
Ube3b T C 5: 114,553,741 (GRCm39) F974L probably benign Het
Ubqln5 A G 7: 103,777,678 (GRCm39) L382P probably damaging Het
Ufsp2 T A 8: 46,436,723 (GRCm39) probably null Het
Unkl C T 17: 25,448,303 (GRCm39) T66I probably damaging Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zzef1 T C 11: 72,749,208 (GRCm39) S899P probably damaging Het
Zzz3 T C 3: 152,161,499 (GRCm39) Y298H probably damaging Het
Other mutations in Xrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Xrn2 APN 2 146,878,670 (GRCm39) missense probably benign 0.00
IGL00950:Xrn2 APN 2 146,870,066 (GRCm39) nonsense probably null
IGL01323:Xrn2 APN 2 146,876,767 (GRCm39) splice site probably benign
IGL01328:Xrn2 APN 2 146,871,850 (GRCm39) missense possibly damaging 0.90
IGL01545:Xrn2 APN 2 146,880,099 (GRCm39) missense probably benign
IGL01729:Xrn2 APN 2 146,878,717 (GRCm39) critical splice donor site probably null
IGL01805:Xrn2 APN 2 146,870,063 (GRCm39) missense probably damaging 0.98
IGL02326:Xrn2 APN 2 146,889,633 (GRCm39) missense probably benign 0.32
IGL02332:Xrn2 APN 2 146,868,510 (GRCm39) missense probably damaging 1.00
IGL02556:Xrn2 APN 2 146,880,216 (GRCm39) splice site probably benign
IGL02609:Xrn2 APN 2 146,891,945 (GRCm39) missense probably benign 0.00
IGL02941:Xrn2 APN 2 146,868,444 (GRCm39) missense probably damaging 1.00
IGL03119:Xrn2 APN 2 146,884,792 (GRCm39) missense probably damaging 1.00
R0052:Xrn2 UTSW 2 146,882,885 (GRCm39) splice site probably benign
R0114:Xrn2 UTSW 2 146,871,699 (GRCm39) missense probably damaging 0.98
R0196:Xrn2 UTSW 2 146,889,580 (GRCm39) missense probably damaging 0.99
R0799:Xrn2 UTSW 2 146,871,818 (GRCm39) missense probably benign 0.03
R0991:Xrn2 UTSW 2 146,884,002 (GRCm39) missense probably benign 0.40
R1444:Xrn2 UTSW 2 146,903,408 (GRCm39) missense probably damaging 0.99
R1727:Xrn2 UTSW 2 146,903,436 (GRCm39) missense probably benign 0.00
R1735:Xrn2 UTSW 2 146,903,343 (GRCm39) missense probably damaging 1.00
R1885:Xrn2 UTSW 2 146,891,281 (GRCm39) nonsense probably null
R2199:Xrn2 UTSW 2 146,866,670 (GRCm39) missense probably damaging 0.96
R2884:Xrn2 UTSW 2 146,889,576 (GRCm39) missense probably damaging 1.00
R3730:Xrn2 UTSW 2 146,866,729 (GRCm39) missense probably benign 0.09
R3771:Xrn2 UTSW 2 146,903,207 (GRCm39) missense probably benign 0.12
R3772:Xrn2 UTSW 2 146,903,207 (GRCm39) missense probably benign 0.12
R3773:Xrn2 UTSW 2 146,903,207 (GRCm39) missense probably benign 0.12
R3816:Xrn2 UTSW 2 146,870,120 (GRCm39) missense probably damaging 1.00
R4173:Xrn2 UTSW 2 146,889,612 (GRCm39) missense probably damaging 0.96
R4659:Xrn2 UTSW 2 146,903,394 (GRCm39) missense probably benign 0.01
R4928:Xrn2 UTSW 2 146,893,638 (GRCm39) missense possibly damaging 0.80
R5452:Xrn2 UTSW 2 146,866,633 (GRCm39) critical splice acceptor site probably null
R5527:Xrn2 UTSW 2 146,871,675 (GRCm39) missense probably benign 0.02
R6297:Xrn2 UTSW 2 146,868,490 (GRCm39) missense probably damaging 1.00
R6301:Xrn2 UTSW 2 146,905,262 (GRCm39) missense probably benign 0.05
R6316:Xrn2 UTSW 2 146,883,930 (GRCm39) missense probably damaging 1.00
R6705:Xrn2 UTSW 2 146,878,582 (GRCm39) critical splice acceptor site probably null
R7173:Xrn2 UTSW 2 146,884,013 (GRCm39) missense probably damaging 1.00
R7408:Xrn2 UTSW 2 146,884,017 (GRCm39) critical splice donor site probably null
R7412:Xrn2 UTSW 2 146,891,266 (GRCm39) missense probably damaging 0.99
R7501:Xrn2 UTSW 2 146,871,676 (GRCm39) missense probably damaging 1.00
R7856:Xrn2 UTSW 2 146,910,393 (GRCm39) splice site probably null
R8912:Xrn2 UTSW 2 146,891,913 (GRCm39) missense probably benign 0.04
R8969:Xrn2 UTSW 2 146,871,304 (GRCm39) missense probably damaging 1.00
R9083:Xrn2 UTSW 2 146,880,199 (GRCm39) missense probably damaging 1.00
R9179:Xrn2 UTSW 2 146,855,081 (GRCm39) missense probably benign 0.04
Z1177:Xrn2 UTSW 2 146,870,126 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GACTGATGTGGGACAAGACC -3'
(R):5'- AACTCTCCACATTAATTACTGCTGG -3'

Sequencing Primer
(F):5'- TGGGACAAGACCAGTCTGTTC -3'
(R):5'- TTGCCACTGTAAGCTAAACAGC -3'
Posted On 2015-04-17