Incidental Mutation 'R3927:Alpk1'
ID 308318
Institutional Source Beutler Lab
Gene Symbol Alpk1
Ensembl Gene ENSMUSG00000028028
Gene Name alpha-kinase 1
Synonyms 8430410J10Rik
MMRRC Submission 040822-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3927 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 127670310-127780527 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127677716 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1039 (H1039R)
Ref Sequence ENSEMBL: ENSMUSP00000143223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029662] [ENSMUST00000198955]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029662
AA Change: H1039R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029662
Gene: ENSMUSG00000028028
AA Change: H1039R

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160586
Predicted Effect probably damaging
Transcript: ENSMUST00000198955
AA Change: H1039R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143223
Gene: ENSMUSG00000028028
AA Change: H1039R

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Meta Mutation Damage Score 0.1775 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha kinase. Mice which were homozygous for disrupted copies of this gene exhibited coordination defects (PMID: 21208416). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A G 2: 103,708,218 probably null Het
Avpr1a A G 10: 122,449,711 S303G probably benign Het
Axdnd1 A G 1: 156,419,270 L79S probably damaging Het
Baz1a A G 12: 54,921,143 I667T possibly damaging Het
Bend5 A G 4: 111,448,605 Y282C possibly damaging Het
Clstn3 T C 6: 124,451,368 D438G probably damaging Het
Cog3 A G 14: 75,743,558 probably benign Het
Cyp2j6 T C 4: 96,553,288 N55S probably benign Het
Eif4b G A 15: 102,084,310 G101R probably damaging Het
Epha2 T C 4: 141,306,550 L40P probably damaging Het
Fig4 A G 10: 41,263,139 V356A probably benign Het
Hal T C 10: 93,514,026 probably benign Het
Helz A G 11: 107,685,292 Y1770C unknown Het
Meis3 A G 7: 16,177,494 T39A probably benign Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Olfr430 A T 1: 174,069,312 N5Y probably damaging Het
Pacsin3 C T 2: 91,262,941 probably null Het
Plekhh1 T A 12: 79,053,648 I130N probably damaging Het
Plxna2 G A 1: 194,746,157 E512K probably benign Het
Ppp1r9a A G 6: 5,057,531 I215M probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Sap130 A T 18: 31,674,382 H414L possibly damaging Het
Slc33a1 A G 3: 63,963,724 I156T probably benign Het
Slc37a2 G A 9: 37,235,507 T338M probably damaging Het
Spinkl T A 18: 44,169,163 probably null Het
Tmc5 T A 7: 118,652,655 L657* probably null Het
Tmem217 A G 17: 29,526,703 S18P probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Tubb4a A G 17: 57,080,967 V353A probably benign Het
Ube3b T C 5: 114,415,680 F974L probably benign Het
Ubqln5 A G 7: 104,128,471 L382P probably damaging Het
Ufsp2 T A 8: 45,983,686 probably null Het
Unkl C T 17: 25,229,329 T66I probably damaging Het
Xrn2 T A 2: 147,038,189 N477K probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zzef1 T C 11: 72,858,382 S899P probably damaging Het
Zzz3 T C 3: 152,455,862 Y298H probably damaging Het
Other mutations in Alpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Alpk1 APN 3 127681043 missense probably damaging 1.00
IGL00722:Alpk1 APN 3 127680213 missense probably benign 0.00
IGL01066:Alpk1 APN 3 127680225 missense probably benign 0.22
IGL01351:Alpk1 APN 3 127672362 missense probably damaging 0.97
IGL01412:Alpk1 APN 3 127679972 missense possibly damaging 0.60
IGL01469:Alpk1 APN 3 127677752 splice site probably null
IGL01585:Alpk1 APN 3 127679813 missense probably benign 0.01
IGL02308:Alpk1 APN 3 127729282 missense probably damaging 0.99
IGL02325:Alpk1 APN 3 127679903 missense probably benign 0.43
IGL02458:Alpk1 APN 3 127681319 critical splice donor site probably null
IGL02553:Alpk1 APN 3 127673321 missense probably damaging 1.00
IGL02717:Alpk1 APN 3 127681100 missense possibly damaging 0.76
IGL02729:Alpk1 APN 3 127681072 missense possibly damaging 0.87
IGL02832:Alpk1 APN 3 127679943 missense possibly damaging 0.63
IGL02892:Alpk1 APN 3 127680122 missense possibly damaging 0.92
IGL03178:Alpk1 APN 3 127680221 nonsense probably null
R0427:Alpk1 UTSW 3 127671071 missense probably damaging 1.00
R0981:Alpk1 UTSW 3 127679402 missense possibly damaging 0.62
R1174:Alpk1 UTSW 3 127680810 missense probably damaging 0.99
R1793:Alpk1 UTSW 3 127677798 missense probably damaging 1.00
R1859:Alpk1 UTSW 3 127681100 missense possibly damaging 0.76
R2173:Alpk1 UTSW 3 127683590 missense probably damaging 1.00
R2235:Alpk1 UTSW 3 127680920 missense probably benign 0.01
R2373:Alpk1 UTSW 3 127679808 missense probably benign 0.00
R3803:Alpk1 UTSW 3 127679837 missense possibly damaging 0.93
R4356:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4357:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4358:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4379:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4381:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4470:Alpk1 UTSW 3 127679526 missense probably damaging 1.00
R4471:Alpk1 UTSW 3 127679526 missense probably damaging 1.00
R4473:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4474:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4476:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4512:Alpk1 UTSW 3 127684471 intron probably benign
R4594:Alpk1 UTSW 3 127683554 missense probably damaging 1.00
R4678:Alpk1 UTSW 3 127679858 missense probably damaging 0.99
R4707:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4784:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4785:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4820:Alpk1 UTSW 3 127671059 missense probably benign 0.06
R4887:Alpk1 UTSW 3 127673475 missense probably damaging 1.00
R5088:Alpk1 UTSW 3 127685320 splice site probably benign
R5169:Alpk1 UTSW 3 127671101 missense probably damaging 1.00
R5280:Alpk1 UTSW 3 127681164 missense probably benign 0.00
R5351:Alpk1 UTSW 3 127729292 missense probably damaging 0.96
R5478:Alpk1 UTSW 3 127677719 missense probably damaging 1.00
R5627:Alpk1 UTSW 3 127680647 missense probably damaging 0.99
R5781:Alpk1 UTSW 3 127680035 missense possibly damaging 0.92
R5842:Alpk1 UTSW 3 127680969 missense probably damaging 1.00
R5847:Alpk1 UTSW 3 127680074 missense probably benign 0.06
R5940:Alpk1 UTSW 3 127670946 missense probably benign
R6187:Alpk1 UTSW 3 127673342 missense probably damaging 1.00
R6306:Alpk1 UTSW 3 127686316 missense probably damaging 1.00
R6414:Alpk1 UTSW 3 127680209 missense probably benign
R6701:Alpk1 UTSW 3 127729336 missense probably damaging 1.00
R6735:Alpk1 UTSW 3 127724449 missense probably damaging 1.00
R6850:Alpk1 UTSW 3 127729363 missense possibly damaging 0.87
R7173:Alpk1 UTSW 3 127684375 nonsense probably null
R7258:Alpk1 UTSW 3 127724466 missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127672494 missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127695733 missense probably damaging 1.00
R7498:Alpk1 UTSW 3 127679778 missense probably benign 0.22
R7635:Alpk1 UTSW 3 127695661 missense probably benign 0.01
R7660:Alpk1 UTSW 3 127680967 missense probably damaging 1.00
R7682:Alpk1 UTSW 3 127672546 missense possibly damaging 0.94
R7732:Alpk1 UTSW 3 127684392 missense
R7827:Alpk1 UTSW 3 127680051 missense probably benign 0.00
R8029:Alpk1 UTSW 3 127729285 missense possibly damaging 0.95
R8383:Alpk1 UTSW 3 127724436 missense probably benign 0.41
R8478:Alpk1 UTSW 3 127729312 missense probably damaging 1.00
R8765:Alpk1 UTSW 3 127672469 missense probably damaging 1.00
R8816:Alpk1 UTSW 3 127684375 nonsense probably null
R8907:Alpk1 UTSW 3 127680993 nonsense probably null
R8972:Alpk1 UTSW 3 127679583 missense probably damaging 1.00
R8974:Alpk1 UTSW 3 127679931 missense probably benign 0.03
R9039:Alpk1 UTSW 3 127679543 missense probably damaging 1.00
R9202:Alpk1 UTSW 3 127686289 missense
R9394:Alpk1 UTSW 3 127672538 missense probably damaging 1.00
R9421:Alpk1 UTSW 3 127673420 missense probably damaging 1.00
R9436:Alpk1 UTSW 3 127685275 missense
R9785:Alpk1 UTSW 3 127679945 missense probably benign 0.22
Z1176:Alpk1 UTSW 3 127673438 missense probably damaging 1.00
Z1177:Alpk1 UTSW 3 127685307 missense
Predicted Primers PCR Primer
(F):5'- AGGCACTCATCTAGCATTATTCC -3'
(R):5'- TGGGCTTGCTGGTTACCAAG -3'

Sequencing Primer
(F):5'- CCGTGATGTATGAAAACTGTTGTC -3'
(R):5'- GCTTGCTGGTTACCAAGACCTG -3'
Posted On 2015-04-17