Mutagenetix > Incidental Mutation

Incidental Mutation 'R3927:Alpk1'

308318

Institutional Source

Beutler Lab

Gene Symbol

Alpk1

Ensembl Gene

ENSMUSG00000028028

Gene Name

alpha-kinase 1

Synonyms

8430410J10Rik

MMRRC Submission

040822-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3927 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127670310-127780527 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 127677716 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1039 (H1039R)

Ref Sequence

ENSEMBL: ENSMUSP00000143223 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029662] [ENSMUST00000198955]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000029662
AA Change: H1039R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029662
Gene: ENSMUSG00000028028
AA Change: H1039R

Domain	Start	End	E-Value	Type
low complexity region	85	97	N/A	INTRINSIC
low complexity region	618	628	N/A	INTRINSIC
low complexity region	700	714	N/A	INTRINSIC
low complexity region	902	914	N/A	INTRINSIC
low complexity region	924	947	N/A	INTRINSIC
Alpha_kinase	1008	1215	1.03e-81	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159720

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160586

Predicted Effect

probably damaging
Transcript: ENSMUST00000198955
AA Change: H1039R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143223
Gene: ENSMUSG00000028028
AA Change: H1039R

Domain	Start	End	E-Value	Type
low complexity region	85	97	N/A	INTRINSIC
low complexity region	618	628	N/A	INTRINSIC
low complexity region	700	714	N/A	INTRINSIC
low complexity region	902	914	N/A	INTRINSIC
low complexity region	924	947	N/A	INTRINSIC
Alpha_kinase	1008	1215	1.03e-81	SMART

Meta Mutation Damage Score

0.1775

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha kinase. Mice which were homozygous for disrupted copies of this gene exhibited coordination defects (PMID: 21208416). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abtb2	A	G	2: 103,708,218		probably null	Het
Avpr1a	A	G	10: 122,449,711	S303G	probably benign	Het
Axdnd1	A	G	1: 156,419,270	L79S	probably damaging	Het
Baz1a	A	G	12: 54,921,143	I667T	possibly damaging	Het
Bend5	A	G	4: 111,448,605	Y282C	possibly damaging	Het
Clstn3	T	C	6: 124,451,368	D438G	probably damaging	Het
Cog3	A	G	14: 75,743,558		probably benign	Het
Cyp2j6	T	C	4: 96,553,288	N55S	probably benign	Het
Eif4b	G	A	15: 102,084,310	G101R	probably damaging	Het
Epha2	T	C	4: 141,306,550	L40P	probably damaging	Het
Fig4	A	G	10: 41,263,139	V356A	probably benign	Het
Hal	T	C	10: 93,514,026		probably benign	Het
Helz	A	G	11: 107,685,292	Y1770C	unknown	Het
Meis3	A	G	7: 16,177,494	T39A	probably benign	Het
Nod1	G	T	6: 54,944,917	R139S	probably benign	Het
Olfr430	A	T	1: 174,069,312	N5Y	probably damaging	Het
Pacsin3	C	T	2: 91,262,941		probably null	Het
Plekhh1	T	A	12: 79,053,648	I130N	probably damaging	Het
Plxna2	G	A	1: 194,746,157	E512K	probably benign	Het
Ppp1r9a	A	G	6: 5,057,531	I215M	probably damaging	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Sap130	A	T	18: 31,674,382	H414L	possibly damaging	Het
Slc33a1	A	G	3: 63,963,724	I156T	probably benign	Het
Slc37a2	G	A	9: 37,235,507	T338M	probably damaging	Het
Spinkl	T	A	18: 44,169,163		probably null	Het
Tmc5	T	A	7: 118,652,655	L657*	probably null	Het
Tmem217	A	G	17: 29,526,703	S18P	probably damaging	Het
Trim43a	GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT	GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT	9: 88,582,989		probably benign	Het
Tubb4a	A	G	17: 57,080,967	V353A	probably benign	Het
Ube3b	T	C	5: 114,415,680	F974L	probably benign	Het
Ubqln5	A	G	7: 104,128,471	L382P	probably damaging	Het
Ufsp2	T	A	8: 45,983,686		probably null	Het
Unkl	C	T	17: 25,229,329	T66I	probably damaging	Het
Xrn2	T	A	2: 147,038,189	N477K	probably benign	Het
Zfhx4	C	T	3: 5,403,358	P2859S	probably benign	Het
Zzef1	T	C	11: 72,858,382	S899P	probably damaging	Het
Zzz3	T	C	3: 152,455,862	Y298H	probably damaging	Het

Other mutations in Alpk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Alpk1	APN	3	127681043	missense	probably damaging	1.00
IGL00722:Alpk1	APN	3	127680213	missense	probably benign	0.00
IGL01066:Alpk1	APN	3	127680225	missense	probably benign	0.22
IGL01351:Alpk1	APN	3	127672362	missense	probably damaging	0.97
IGL01412:Alpk1	APN	3	127679972	missense	possibly damaging	0.60
IGL01469:Alpk1	APN	3	127677752	splice site	probably null
IGL01585:Alpk1	APN	3	127679813	missense	probably benign	0.01
IGL02308:Alpk1	APN	3	127729282	missense	probably damaging	0.99
IGL02325:Alpk1	APN	3	127679903	missense	probably benign	0.43
IGL02458:Alpk1	APN	3	127681319	critical splice donor site	probably null
IGL02553:Alpk1	APN	3	127673321	missense	probably damaging	1.00
IGL02717:Alpk1	APN	3	127681100	missense	possibly damaging	0.76
IGL02729:Alpk1	APN	3	127681072	missense	possibly damaging	0.87
IGL02832:Alpk1	APN	3	127679943	missense	possibly damaging	0.63
IGL02892:Alpk1	APN	3	127680122	missense	possibly damaging	0.92
IGL03178:Alpk1	APN	3	127680221	nonsense	probably null
R0427:Alpk1	UTSW	3	127671071	missense	probably damaging	1.00
R0981:Alpk1	UTSW	3	127679402	missense	possibly damaging	0.62
R1174:Alpk1	UTSW	3	127680810	missense	probably damaging	0.99
R1793:Alpk1	UTSW	3	127677798	missense	probably damaging	1.00
R1859:Alpk1	UTSW	3	127681100	missense	possibly damaging	0.76
R2173:Alpk1	UTSW	3	127683590	missense	probably damaging	1.00
R2235:Alpk1	UTSW	3	127680920	missense	probably benign	0.01
R2373:Alpk1	UTSW	3	127679808	missense	probably benign	0.00
R3803:Alpk1	UTSW	3	127679837	missense	possibly damaging	0.93
R4356:Alpk1	UTSW	3	127729373	missense	probably damaging	0.98
R4357:Alpk1	UTSW	3	127729373	missense	probably damaging	0.98
R4358:Alpk1	UTSW	3	127729373	missense	probably damaging	0.98
R4379:Alpk1	UTSW	3	127729373	missense	probably damaging	0.98
R4381:Alpk1	UTSW	3	127729373	missense	probably damaging	0.98
R4470:Alpk1	UTSW	3	127679526	missense	probably damaging	1.00
R4471:Alpk1	UTSW	3	127679526	missense	probably damaging	1.00
R4473:Alpk1	UTSW	3	127680018	missense	probably damaging	0.97
R4474:Alpk1	UTSW	3	127680018	missense	probably damaging	0.97
R4476:Alpk1	UTSW	3	127680018	missense	probably damaging	0.97
R4512:Alpk1	UTSW	3	127684471	intron	probably benign
R4594:Alpk1	UTSW	3	127683554	missense	probably damaging	1.00
R4678:Alpk1	UTSW	3	127679858	missense	probably damaging	0.99
R4707:Alpk1	UTSW	3	127687592	missense	possibly damaging	0.50
R4784:Alpk1	UTSW	3	127687592	missense	possibly damaging	0.50
R4785:Alpk1	UTSW	3	127687592	missense	possibly damaging	0.50
R4820:Alpk1	UTSW	3	127671059	missense	probably benign	0.06
R4887:Alpk1	UTSW	3	127673475	missense	probably damaging	1.00
R5088:Alpk1	UTSW	3	127685320	splice site	probably benign
R5169:Alpk1	UTSW	3	127671101	missense	probably damaging	1.00
R5280:Alpk1	UTSW	3	127681164	missense	probably benign	0.00
R5351:Alpk1	UTSW	3	127729292	missense	probably damaging	0.96
R5478:Alpk1	UTSW	3	127677719	missense	probably damaging	1.00
R5627:Alpk1	UTSW	3	127680647	missense	probably damaging	0.99
R5781:Alpk1	UTSW	3	127680035	missense	possibly damaging	0.92
R5842:Alpk1	UTSW	3	127680969	missense	probably damaging	1.00
R5847:Alpk1	UTSW	3	127680074	missense	probably benign	0.06
R5940:Alpk1	UTSW	3	127670946	missense	probably benign
R6187:Alpk1	UTSW	3	127673342	missense	probably damaging	1.00
R6306:Alpk1	UTSW	3	127686316	missense	probably damaging	1.00
R6414:Alpk1	UTSW	3	127680209	missense	probably benign
R6701:Alpk1	UTSW	3	127729336	missense	probably damaging	1.00
R6735:Alpk1	UTSW	3	127724449	missense	probably damaging	1.00
R6850:Alpk1	UTSW	3	127729363	missense	possibly damaging	0.87
R7173:Alpk1	UTSW	3	127684375	nonsense	probably null
R7258:Alpk1	UTSW	3	127724466	missense	probably damaging	1.00
R7412:Alpk1	UTSW	3	127672494	missense	probably damaging	1.00
R7412:Alpk1	UTSW	3	127695733	missense	probably damaging	1.00
R7498:Alpk1	UTSW	3	127679778	missense	probably benign	0.22
R7635:Alpk1	UTSW	3	127695661	missense	probably benign	0.01
R7660:Alpk1	UTSW	3	127680967	missense	probably damaging	1.00
R7682:Alpk1	UTSW	3	127672546	missense	possibly damaging	0.94
R7732:Alpk1	UTSW	3	127684392	missense
R7827:Alpk1	UTSW	3	127680051	missense	probably benign	0.00
R8029:Alpk1	UTSW	3	127729285	missense	possibly damaging	0.95
R8383:Alpk1	UTSW	3	127724436	missense	probably benign	0.41
R8478:Alpk1	UTSW	3	127729312	missense	probably damaging	1.00
R8765:Alpk1	UTSW	3	127672469	missense	probably damaging	1.00
R8816:Alpk1	UTSW	3	127684375	nonsense	probably null
R8907:Alpk1	UTSW	3	127680993	nonsense	probably null
R8972:Alpk1	UTSW	3	127679583	missense	probably damaging	1.00
R8974:Alpk1	UTSW	3	127679931	missense	probably benign	0.03
R9039:Alpk1	UTSW	3	127679543	missense	probably damaging	1.00
R9202:Alpk1	UTSW	3	127686289	missense
R9394:Alpk1	UTSW	3	127672538	missense	probably damaging	1.00
R9421:Alpk1	UTSW	3	127673420	missense	probably damaging	1.00
R9436:Alpk1	UTSW	3	127685275	missense
R9785:Alpk1	UTSW	3	127679945	missense	probably benign	0.22
Z1176:Alpk1	UTSW	3	127673438	missense	probably damaging	1.00
Z1177:Alpk1	UTSW	3	127685307	missense

Predicted Primers

PCR Primer
(F):5'- AGGCACTCATCTAGCATTATTCC -3'
(R):5'- TGGGCTTGCTGGTTACCAAG -3'

Sequencing Primer
(F):5'- CCGTGATGTATGAAAACTGTTGTC -3'
(R):5'- GCTTGCTGGTTACCAAGACCTG -3'

Posted On

2015-04-17