Incidental Mutation 'R0377:Btaf1'
ID30832
Institutional Source Beutler Lab
Gene Symbol Btaf1
Ensembl Gene ENSMUSG00000040565
Gene NameB-TFIID TATA-box binding protein associated factor 1
SynonymsE430027O22Rik
MMRRC Submission 038583-MU
Accession Numbers

Genbank: NM_001080706

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R0377 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location36926079-37012752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36989002 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1057 (K1057E)
Ref Sequence ENSEMBL: ENSMUSP00000097093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099494]
Predicted Effect probably benign
Transcript: ENSMUST00000099494
AA Change: K1057E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: K1057E

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 143 152 N/A INTRINSIC
PDB:3OC3|B 276 414 3e-6 PDB
low complexity region 438 454 N/A INTRINSIC
Pfam:DUF3535 585 1051 1.1e-133 PFAM
low complexity region 1099 1110 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
DEXDc 1261 1469 3.02e-30 SMART
low complexity region 1630 1641 N/A INTRINSIC
HELICc 1657 1743 2.22e-19 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C A 11: 94,375,096 V107F possibly damaging Het
Acad11 T A 9: 104,081,692 probably benign Het
Ache G A 5: 137,290,928 E299K possibly damaging Het
Adam5 T C 8: 24,747,541 T618A probably benign Het
Amigo2 T A 15: 97,246,380 T54S possibly damaging Het
Anapc1 A G 2: 128,641,340 probably null Het
Armc4 G A 18: 7,127,415 R933C probably benign Het
Cep55 T A 19: 38,071,889 L396* probably null Het
Cic C A 7: 25,285,799 H1157N probably damaging Het
Cntnap5a A T 1: 116,292,529 T690S probably benign Het
D5Ertd579e A T 5: 36,604,567 C1319S probably benign Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Dntt G A 19: 41,047,627 W369* probably null Het
Esp18 T A 17: 39,409,944 W27R probably benign Het
Fam227b A T 2: 126,125,000 probably benign Het
Fbxo31 G A 8: 121,559,102 probably benign Het
Gm13547 G A 2: 29,761,791 probably null Het
Gnl2 T A 4: 125,046,382 probably benign Het
Gpx2 G A 12: 76,795,156 Q74* probably null Het
Gucy2c A G 6: 136,750,917 probably null Het
Hoxa5 A T 6: 52,202,646 W250R probably damaging Het
Izumo4 G A 10: 80,702,840 R42H probably damaging Het
Kcnj12 G A 11: 61,069,396 M71I probably benign Het
Kmt2b A T 7: 30,574,193 L2333Q probably damaging Het
Mak T C 13: 41,049,348 E177G probably damaging Het
Map3k7 T A 4: 31,985,731 I218N probably damaging Het
Mark3 T C 12: 111,629,029 L393P probably damaging Het
Msh4 A G 3: 153,896,890 S234P probably benign Het
Mug1 A G 6: 121,857,361 D367G probably benign Het
Mypn A G 10: 63,127,622 probably benign Het
Ncapg T C 5: 45,693,817 V784A probably benign Het
Nutf2 T A 8: 105,878,872 V113D probably damaging Het
Olfr1080 A T 2: 86,553,583 D180E probably damaging Het
Opn3 T C 1: 175,663,694 M258V probably damaging Het
Osbpl7 A G 11: 97,055,934 D211G probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plekhd1 G A 12: 80,706,436 probably benign Het
Pnpla6 A G 8: 3,541,501 E1165G probably damaging Het
Prkab2 T A 3: 97,662,317 D66E probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptpn23 A T 9: 110,388,132 S885R possibly damaging Het
Rab26 A T 17: 24,530,045 probably benign Het
Rab5a G A 17: 53,500,462 M175I probably benign Het
Rassf9 T A 10: 102,545,649 D297E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Rtp1 A G 16: 23,431,284 Y133C probably damaging Het
Sdr16c5 G A 4: 4,005,546 L263F probably benign Het
Sec14l1 T G 11: 117,149,140 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca1 T C 4: 34,044,267 probably null Het
Stk36 C T 1: 74,612,730 P394L probably benign Het
Stk4 T C 2: 164,096,800 I196T probably damaging Het
Sult1b1 A T 5: 87,517,376 M233K probably damaging Het
Tmem8b C T 4: 43,674,005 T212M probably damaging Het
Tmprss11g A T 5: 86,490,751 F293I probably damaging Het
Tnfsf11 T G 14: 78,299,912 T104P probably benign Het
Trmt2a G A 16: 18,249,703 R80Q possibly damaging Het
Trps1 C A 15: 50,831,778 E324* probably null Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Wdr18 G A 10: 79,967,502 R400H probably benign Het
Wdr78 A G 4: 103,048,259 V775A probably damaging Het
Zfp119b T A 17: 55,938,671 H505L probably damaging Het
Zfp619 T A 7: 39,536,797 C750* probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Btaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Btaf1 APN 19 37009702 missense probably damaging 1.00
IGL00535:Btaf1 APN 19 36997535 missense probably damaging 1.00
IGL00574:Btaf1 APN 19 36969930 missense probably benign 0.00
IGL00969:Btaf1 APN 19 37011252 splice site probably benign
IGL01325:Btaf1 APN 19 37004649 splice site probably benign
IGL01399:Btaf1 APN 19 37000170 nonsense probably null
IGL02024:Btaf1 APN 19 36992426 splice site probably benign
IGL02471:Btaf1 APN 19 37000192 missense probably damaging 0.96
IGL02664:Btaf1 APN 19 36978428 splice site probably benign
IGL02898:Btaf1 APN 19 36969068 missense probably benign
IGL02995:Btaf1 APN 19 36981135 splice site probably benign
IGL03023:Btaf1 APN 19 37010015 missense possibly damaging 0.85
IGL03188:Btaf1 APN 19 36949108 missense possibly damaging 0.91
IGL03353:Btaf1 APN 19 36992500 missense probably damaging 1.00
freudenberg UTSW 19 36988173 critical splice donor site probably null
Galanos UTSW 19 36949102 missense probably damaging 1.00
3-1:Btaf1 UTSW 19 37010078 missense probably damaging 1.00
R0013:Btaf1 UTSW 19 36958373 missense probably benign
R0048:Btaf1 UTSW 19 37003524 missense probably benign 0.01
R0117:Btaf1 UTSW 19 36969968 missense probably benign 0.06
R0207:Btaf1 UTSW 19 37009648 nonsense probably null
R0310:Btaf1 UTSW 19 37004534 missense probably damaging 0.96
R0419:Btaf1 UTSW 19 36945229 missense probably damaging 0.99
R0440:Btaf1 UTSW 19 36986653 missense probably damaging 0.99
R0532:Btaf1 UTSW 19 36951186 splice site probably benign
R0612:Btaf1 UTSW 19 36969137 missense probably damaging 0.99
R0731:Btaf1 UTSW 19 36997495 splice site probably null
R0780:Btaf1 UTSW 19 36988922 missense probably damaging 0.99
R0919:Btaf1 UTSW 19 36990743 missense probably benign 0.03
R1104:Btaf1 UTSW 19 37004602 missense probably damaging 1.00
R1263:Btaf1 UTSW 19 36956524 missense probably benign 0.10
R1325:Btaf1 UTSW 19 36969162 missense possibly damaging 0.68
R1447:Btaf1 UTSW 19 36992454 missense probably benign 0.00
R1554:Btaf1 UTSW 19 36996598 missense probably benign 0.02
R1649:Btaf1 UTSW 19 36981722 missense probably benign
R1715:Btaf1 UTSW 19 36969121 missense probably damaging 0.99
R1733:Btaf1 UTSW 19 36994962 missense probably benign
R1764:Btaf1 UTSW 19 36951118 missense probably benign 0.12
R1874:Btaf1 UTSW 19 36980583 missense probably benign
R1911:Btaf1 UTSW 19 36986630 missense probably benign
R1933:Btaf1 UTSW 19 36972957 missense probably damaging 1.00
R2080:Btaf1 UTSW 19 36951148 missense probably benign 0.09
R2483:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R2510:Btaf1 UTSW 19 37002445 missense probably benign 0.08
R3623:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3624:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3801:Btaf1 UTSW 19 36986548 missense probably benign
R3801:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3802:Btaf1 UTSW 19 36986548 missense probably benign
R3802:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3803:Btaf1 UTSW 19 36986548 missense probably benign
R3803:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R4077:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4079:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4133:Btaf1 UTSW 19 36961738 missense probably benign 0.00
R4673:Btaf1 UTSW 19 36978372 missense probably benign 0.00
R4731:Btaf1 UTSW 19 36981078 missense probably benign 0.03
R4796:Btaf1 UTSW 19 36956428 missense possibly damaging 0.95
R4824:Btaf1 UTSW 19 36981048 missense possibly damaging 0.84
R4835:Btaf1 UTSW 19 37002458 missense probably benign 0.00
R4837:Btaf1 UTSW 19 36966785 missense probably benign
R4925:Btaf1 UTSW 19 37011333 missense probably benign
R4968:Btaf1 UTSW 19 36969951 missense probably null 0.71
R4976:Btaf1 UTSW 19 36986579 missense probably benign
R5001:Btaf1 UTSW 19 36986652 missense possibly damaging 0.90
R5037:Btaf1 UTSW 19 37003531 missense probably damaging 1.00
R5039:Btaf1 UTSW 19 36990762 missense probably benign
R5211:Btaf1 UTSW 19 36996562 missense probably benign 0.32
R5422:Btaf1 UTSW 19 36951107 missense probably benign 0.09
R5429:Btaf1 UTSW 19 36994857 missense possibly damaging 0.58
R5530:Btaf1 UTSW 19 36990775 missense possibly damaging 0.85
R5582:Btaf1 UTSW 19 36988173 critical splice donor site probably null
R5654:Btaf1 UTSW 19 36983615 missense probably benign 0.35
R5744:Btaf1 UTSW 19 37004490 missense probably benign 0.02
R6082:Btaf1 UTSW 19 36983542 missense probably damaging 1.00
R6243:Btaf1 UTSW 19 36981120 missense probably benign 0.02
R6291:Btaf1 UTSW 19 36973008 missense probably benign 0.00
R6502:Btaf1 UTSW 19 36983617 missense probably benign
R7034:Btaf1 UTSW 19 37004469 missense probably benign
R7036:Btaf1 UTSW 19 37004469 missense probably benign
R7085:Btaf1 UTSW 19 36972918 missense probably benign
R7097:Btaf1 UTSW 19 36949102 missense probably damaging 1.00
R7248:Btaf1 UTSW 19 36945314 missense possibly damaging 0.54
R7386:Btaf1 UTSW 19 36958382 missense probably benign 0.02
R7402:Btaf1 UTSW 19 37003515 missense probably damaging 1.00
R7452:Btaf1 UTSW 19 36969127 missense probably damaging 1.00
R7493:Btaf1 UTSW 19 37009605 missense probably damaging 1.00
R7513:Btaf1 UTSW 19 36978403 missense probably benign 0.30
R7888:Btaf1 UTSW 19 36965636 missense probably benign 0.10
R7971:Btaf1 UTSW 19 36965636 missense probably benign 0.10
R8062:Btaf1 UTSW 19 36992465 missense probably benign 0.00
W0251:Btaf1 UTSW 19 37003504 missense probably damaging 1.00
X0027:Btaf1 UTSW 19 36949096 nonsense probably null
Z1088:Btaf1 UTSW 19 36986618 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATTGTAAGACGTGGGCACTTACC -3'
(R):5'- TTTCCAGGAGGGACTTTCCATCTATTCA -3'

Sequencing Primer
(F):5'- CTGGTGACTGTCTTTAGAAATAGC -3'
(R):5'- TACTGCACTTAAAAGCAACTGAAGAG -3'
Posted On2013-04-24