Incidental Mutation 'R3927:Ubqln5'
ID 308330
Institutional Source Beutler Lab
Gene Symbol Ubqln5
Ensembl Gene ENSMUSG00000055643
Gene Name ubiquilin 5
Synonyms 4931431F19Rik
MMRRC Submission 040822-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R3927 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 104127912-104129826 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104128471 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 382 (L382P)
Ref Sequence ENSEMBL: ENSMUSP00000062054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053743] [ENSMUST00000138055]
AlphaFold Q9D4I8
PDB Structure Solution Structure of RSGI RUH-016, a UBA Domain from mouse cDNA [SOLUTION NMR]
Solution Structure of the N-terminal Ubiquitin-like Domain in the 4931431F19Rik Protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000053743
AA Change: L382P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062054
Gene: ENSMUSG00000055643
AA Change: L382P

DomainStartEndE-ValueType
UBQ 24 94 7.97e-13 SMART
low complexity region 365 376 N/A INTRINSIC
UBA 468 506 2.14e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A G 2: 103,708,218 probably null Het
Alpk1 T C 3: 127,677,716 H1039R probably damaging Het
Avpr1a A G 10: 122,449,711 S303G probably benign Het
Axdnd1 A G 1: 156,419,270 L79S probably damaging Het
Baz1a A G 12: 54,921,143 I667T possibly damaging Het
Bend5 A G 4: 111,448,605 Y282C possibly damaging Het
Clstn3 T C 6: 124,451,368 D438G probably damaging Het
Cog3 A G 14: 75,743,558 probably benign Het
Cyp2j6 T C 4: 96,553,288 N55S probably benign Het
Eif4b G A 15: 102,084,310 G101R probably damaging Het
Epha2 T C 4: 141,306,550 L40P probably damaging Het
Fig4 A G 10: 41,263,139 V356A probably benign Het
Hal T C 10: 93,514,026 probably benign Het
Helz A G 11: 107,685,292 Y1770C unknown Het
Meis3 A G 7: 16,177,494 T39A probably benign Het
Nod1 G T 6: 54,944,917 R139S probably benign Het
Olfr430 A T 1: 174,069,312 N5Y probably damaging Het
Pacsin3 C T 2: 91,262,941 probably null Het
Plekhh1 T A 12: 79,053,648 I130N probably damaging Het
Plxna2 G A 1: 194,746,157 E512K probably benign Het
Ppp1r9a A G 6: 5,057,531 I215M probably damaging Het
Ryr3 C G 2: 112,675,873 R3443P probably damaging Het
Sap130 A T 18: 31,674,382 H414L possibly damaging Het
Slc33a1 A G 3: 63,963,724 I156T probably benign Het
Slc37a2 G A 9: 37,235,507 T338M probably damaging Het
Spinkl T A 18: 44,169,163 probably null Het
Tmc5 T A 7: 118,652,655 L657* probably null Het
Tmem217 A G 17: 29,526,703 S18P probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,582,989 probably benign Het
Tubb4a A G 17: 57,080,967 V353A probably benign Het
Ube3b T C 5: 114,415,680 F974L probably benign Het
Ufsp2 T A 8: 45,983,686 probably null Het
Unkl C T 17: 25,229,329 T66I probably damaging Het
Xrn2 T A 2: 147,038,189 N477K probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zzef1 T C 11: 72,858,382 S899P probably damaging Het
Zzz3 T C 3: 152,455,862 Y298H probably damaging Het
Other mutations in Ubqln5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Ubqln5 APN 7 104128427 missense possibly damaging 0.83
IGL02127:Ubqln5 APN 7 104129482 missense probably damaging 0.99
IGL02565:Ubqln5 APN 7 104129072 nonsense probably null
R1181:Ubqln5 UTSW 7 104128741 missense probably damaging 0.99
R1962:Ubqln5 UTSW 7 104128888 missense possibly damaging 0.83
R1962:Ubqln5 UTSW 7 104128927 missense probably damaging 0.98
R1964:Ubqln5 UTSW 7 104128888 missense possibly damaging 0.83
R1992:Ubqln5 UTSW 7 104129534 missense probably damaging 1.00
R1998:Ubqln5 UTSW 7 104128741 missense probably damaging 0.99
R4831:Ubqln5 UTSW 7 104129622 intron probably benign
R5699:Ubqln5 UTSW 7 104129425 missense possibly damaging 0.78
R5840:Ubqln5 UTSW 7 104128954 missense possibly damaging 0.83
R5858:Ubqln5 UTSW 7 104128811 missense probably benign 0.17
R5907:Ubqln5 UTSW 7 104128574 missense possibly damaging 0.55
R6477:Ubqln5 UTSW 7 104128258 missense probably damaging 0.97
R6602:Ubqln5 UTSW 7 104129489 missense probably benign 0.07
R6919:Ubqln5 UTSW 7 104129008 missense probably benign 0.15
R6981:Ubqln5 UTSW 7 104128601 missense probably benign 0.29
R8153:Ubqln5 UTSW 7 104128804 missense possibly damaging 0.52
R8712:Ubqln5 UTSW 7 104129115 missense probably benign 0.04
R8787:Ubqln5 UTSW 7 104129122 missense probably benign 0.01
R9398:Ubqln5 UTSW 7 104128778 missense probably benign 0.05
X0028:Ubqln5 UTSW 7 104129408 missense probably damaging 1.00
Z1088:Ubqln5 UTSW 7 104128971 missense possibly damaging 0.83
Z1176:Ubqln5 UTSW 7 104128918 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GCAGTGCAGTTTGGGAAGAC -3'
(R):5'- CCCTTGGAGAAAGTCCCTCTAAC -3'

Sequencing Primer
(F):5'- TGGGAACAGGCTCTGGC -3'
(R):5'- TGGAGAAAGTCCCTCTAACCTGTC -3'
Posted On 2015-04-17