Incidental Mutation 'R3927:Tmc5'
ID 308331
Institutional Source Beutler Lab
Gene Symbol Tmc5
Ensembl Gene ENSMUSG00000030650
Gene Name transmembrane channel-like gene family 5
Synonyms 4932443L08Rik
MMRRC Submission 040822-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R3927 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 118196520-118274308 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 118251878 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 657 (L657*)
Ref Sequence ENSEMBL: ENSMUSP00000114137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057320] [ENSMUST00000098088] [ENSMUST00000121715] [ENSMUST00000121744]
AlphaFold Q32NZ6
Predicted Effect probably null
Transcript: ENSMUST00000057320
AA Change: L447*
SMART Domains Protein: ENSMUSP00000049784
Gene: ENSMUSG00000030650
AA Change: L447*

DomainStartEndE-ValueType
transmembrane domain 203 225 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 275 297 N/A INTRINSIC
transmembrane domain 371 393 N/A INTRINSIC
transmembrane domain 408 430 N/A INTRINSIC
transmembrane domain 451 473 N/A INTRINSIC
Pfam:TMC 476 581 8.1e-44 PFAM
transmembrane domain 586 608 N/A INTRINSIC
transmembrane domain 652 674 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098088
AA Change: L657*
SMART Domains Protein: ENSMUSP00000095694
Gene: ENSMUSG00000030650
AA Change: L657*

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.2e-42 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121715
AA Change: L657*
SMART Domains Protein: ENSMUSP00000112434
Gene: ENSMUSG00000030650
AA Change: L657*

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.1e-43 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000121744
AA Change: L657*
SMART Domains Protein: ENSMUSP00000114137
Gene: ENSMUSG00000030650
AA Change: L657*

DomainStartEndE-ValueType
internal_repeat_1 7 105 2.08e-10 PROSPERO
internal_repeat_2 10 108 2.75e-10 PROSPERO
internal_repeat_2 127 234 2.75e-10 PROSPERO
internal_repeat_1 152 266 2.08e-10 PROSPERO
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 618 640 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
Pfam:TMC 686 791 1.1e-43 PFAM
transmembrane domain 796 818 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 95% (40/42)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A G 2: 103,538,563 (GRCm39) probably null Het
Alpk1 T C 3: 127,471,365 (GRCm39) H1039R probably damaging Het
Avpr1a A G 10: 122,285,616 (GRCm39) S303G probably benign Het
Axdnd1 A G 1: 156,246,840 (GRCm39) L79S probably damaging Het
Baz1a A G 12: 54,967,928 (GRCm39) I667T possibly damaging Het
Bend5 A G 4: 111,305,802 (GRCm39) Y282C possibly damaging Het
Clstn3 T C 6: 124,428,327 (GRCm39) D438G probably damaging Het
Cog3 A G 14: 75,980,998 (GRCm39) probably benign Het
Cyp2j6 T C 4: 96,441,525 (GRCm39) N55S probably benign Het
Eif4b G A 15: 101,992,745 (GRCm39) G101R probably damaging Het
Epha2 T C 4: 141,033,861 (GRCm39) L40P probably damaging Het
Fig4 A G 10: 41,139,135 (GRCm39) V356A probably benign Het
Hal T C 10: 93,349,888 (GRCm39) probably benign Het
Helz A G 11: 107,576,118 (GRCm39) Y1770C unknown Het
Meis3 A G 7: 15,911,419 (GRCm39) T39A probably benign Het
Nod1 G T 6: 54,921,902 (GRCm39) R139S probably benign Het
Or6n2 A T 1: 173,896,878 (GRCm39) N5Y probably damaging Het
Pacsin3 C T 2: 91,093,286 (GRCm39) probably null Het
Plekhh1 T A 12: 79,100,422 (GRCm39) I130N probably damaging Het
Plxna2 G A 1: 194,428,465 (GRCm39) E512K probably benign Het
Ppp1r9a A G 6: 5,057,531 (GRCm39) I215M probably damaging Het
Ryr3 C G 2: 112,506,218 (GRCm39) R3443P probably damaging Het
Sap130 A T 18: 31,807,435 (GRCm39) H414L possibly damaging Het
Slc33a1 A G 3: 63,871,145 (GRCm39) I156T probably benign Het
Slc37a2 G A 9: 37,146,803 (GRCm39) T338M probably damaging Het
Spinkl T A 18: 44,302,230 (GRCm39) probably null Het
Tmem217 A G 17: 29,745,677 (GRCm39) S18P probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,465,042 (GRCm39) probably benign Het
Tubb4a A G 17: 57,387,967 (GRCm39) V353A probably benign Het
Ube3b T C 5: 114,553,741 (GRCm39) F974L probably benign Het
Ubqln5 A G 7: 103,777,678 (GRCm39) L382P probably damaging Het
Ufsp2 T A 8: 46,436,723 (GRCm39) probably null Het
Unkl C T 17: 25,448,303 (GRCm39) T66I probably damaging Het
Xrn2 T A 2: 146,880,109 (GRCm39) N477K probably benign Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zzef1 T C 11: 72,749,208 (GRCm39) S899P probably damaging Het
Zzz3 T C 3: 152,161,499 (GRCm39) Y298H probably damaging Het
Other mutations in Tmc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Tmc5 APN 7 118,256,010 (GRCm39) missense probably damaging 1.00
IGL01601:Tmc5 APN 7 118,223,047 (GRCm39) unclassified probably benign
IGL01633:Tmc5 APN 7 118,222,809 (GRCm39) missense probably damaging 0.97
IGL01845:Tmc5 APN 7 118,251,733 (GRCm39) missense possibly damaging 0.93
IGL02148:Tmc5 APN 7 118,244,547 (GRCm39) missense probably damaging 0.97
IGL02638:Tmc5 APN 7 118,226,456 (GRCm39) missense probably benign 0.36
IGL02890:Tmc5 APN 7 118,244,653 (GRCm39) splice site probably benign
hipster UTSW 7 118,265,834 (GRCm39) critical splice donor site probably null
F5426:Tmc5 UTSW 7 118,222,546 (GRCm39) missense probably benign
PIT4802001:Tmc5 UTSW 7 118,271,449 (GRCm39) missense probably benign
R0068:Tmc5 UTSW 7 118,233,460 (GRCm39) missense probably benign 0.44
R0470:Tmc5 UTSW 7 118,239,154 (GRCm39) missense possibly damaging 0.68
R0520:Tmc5 UTSW 7 118,265,799 (GRCm39) missense probably damaging 1.00
R0786:Tmc5 UTSW 7 118,226,433 (GRCm39) missense possibly damaging 0.94
R1263:Tmc5 UTSW 7 118,266,093 (GRCm39) missense probably damaging 1.00
R1269:Tmc5 UTSW 7 118,265,816 (GRCm39) missense probably benign 0.30
R1486:Tmc5 UTSW 7 118,272,655 (GRCm39) missense probably benign 0.02
R1702:Tmc5 UTSW 7 118,271,462 (GRCm39) missense probably benign 0.00
R2188:Tmc5 UTSW 7 118,254,178 (GRCm39) missense probably damaging 1.00
R3508:Tmc5 UTSW 7 118,244,618 (GRCm39) missense probably benign 0.01
R3893:Tmc5 UTSW 7 118,244,592 (GRCm39) missense probably damaging 1.00
R4171:Tmc5 UTSW 7 118,248,810 (GRCm39) missense probably damaging 0.99
R4279:Tmc5 UTSW 7 118,273,886 (GRCm39) makesense probably null
R4554:Tmc5 UTSW 7 118,269,956 (GRCm39) missense probably benign 0.16
R4555:Tmc5 UTSW 7 118,269,956 (GRCm39) missense probably benign 0.16
R4557:Tmc5 UTSW 7 118,269,956 (GRCm39) missense probably benign 0.16
R4833:Tmc5 UTSW 7 118,228,052 (GRCm39) missense probably benign 0.11
R4845:Tmc5 UTSW 7 118,241,604 (GRCm39) missense probably damaging 1.00
R4852:Tmc5 UTSW 7 118,244,562 (GRCm39) missense probably benign 0.32
R5087:Tmc5 UTSW 7 118,244,609 (GRCm39) missense possibly damaging 0.68
R5214:Tmc5 UTSW 7 118,247,155 (GRCm39) missense probably damaging 1.00
R5723:Tmc5 UTSW 7 118,271,416 (GRCm39) missense probably damaging 1.00
R5739:Tmc5 UTSW 7 118,265,834 (GRCm39) critical splice donor site probably null
R5882:Tmc5 UTSW 7 118,254,142 (GRCm39) missense probably damaging 0.99
R5946:Tmc5 UTSW 7 118,269,948 (GRCm39) missense probably damaging 1.00
R6244:Tmc5 UTSW 7 118,233,437 (GRCm39) missense possibly damaging 0.93
R6360:Tmc5 UTSW 7 118,233,189 (GRCm39) start codon destroyed probably null 1.00
R6375:Tmc5 UTSW 7 118,256,037 (GRCm39) missense probably damaging 1.00
R6458:Tmc5 UTSW 7 118,244,539 (GRCm39) missense probably damaging 1.00
R6566:Tmc5 UTSW 7 118,247,067 (GRCm39) missense probably damaging 1.00
R6681:Tmc5 UTSW 7 118,268,527 (GRCm39) missense probably damaging 1.00
R7202:Tmc5 UTSW 7 118,239,179 (GRCm39) missense possibly damaging 0.49
R7227:Tmc5 UTSW 7 118,269,889 (GRCm39) missense possibly damaging 0.81
R7410:Tmc5 UTSW 7 118,222,820 (GRCm39) nonsense probably null
R7562:Tmc5 UTSW 7 118,222,549 (GRCm39) missense probably benign 0.10
R7808:Tmc5 UTSW 7 118,268,440 (GRCm39) missense probably damaging 1.00
R8560:Tmc5 UTSW 7 118,268,514 (GRCm39) missense probably damaging 1.00
R8682:Tmc5 UTSW 7 118,269,925 (GRCm39) missense possibly damaging 0.77
R8778:Tmc5 UTSW 7 118,222,816 (GRCm39) missense unknown
R8832:Tmc5 UTSW 7 118,222,332 (GRCm39) missense probably benign 0.06
R9026:Tmc5 UTSW 7 118,241,594 (GRCm39) missense possibly damaging 0.92
R9064:Tmc5 UTSW 7 118,233,270 (GRCm39) missense probably benign 0.01
R9159:Tmc5 UTSW 7 118,233,264 (GRCm39) missense probably benign
R9258:Tmc5 UTSW 7 118,222,501 (GRCm39) missense probably benign 0.00
Z1177:Tmc5 UTSW 7 118,222,979 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGAGACCCTCTGAGTGTG -3'
(R):5'- GGGTTAGGTTAACTCCTGGGAC -3'

Sequencing Primer
(F):5'- AGACCCTCTGAGTGTGTGGAGAG -3'
(R):5'- CTTTCAGTGATGAACAGCAAAGC -3'
Posted On 2015-04-17