Incidental Mutation 'R3927:Fig4'
ID 308335
Institutional Source Beutler Lab
Gene Symbol Fig4
Ensembl Gene ENSMUSG00000038417
Gene Name FIG4 phosphoinositide 5-phosphatase
Synonyms A530089I17Rik
MMRRC Submission 040822-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.530) question?
Stock # R3927 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 41064168-41179237 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41139135 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 356 (V356A)
Ref Sequence ENSEMBL: ENSMUSP00000039598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043814]
AlphaFold Q91WF7
Predicted Effect probably benign
Transcript: ENSMUST00000043814
AA Change: V356A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039598
Gene: ENSMUSG00000038417
AA Change: V356A

DomainStartEndE-ValueType
Pfam:Syja_N 93 424 1.7e-79 PFAM
Blast:Lactamase_B 533 610 6e-21 BLAST
low complexity region 742 771 N/A INTRINSIC
low complexity region 805 813 N/A INTRINSIC
Meta Mutation Damage Score 0.0664 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SAC domain-containing protein gene family. The SAC domain, approximately 400 amino acids in length and consisting of seven conserved motifs, has been shown to possess phosphoinositide phosphatase activity. The yeast homolog, Sac1p, is involved in the regulation of various phosphoinositides, and affects diverse cellular functions such as actin cytoskeleton organization, Golgi function, and maintenance of vacuole morphology. Membrane-bound phosphoinositides function as signaling molecules and play a key role in vesicle trafficking in eukaryotic cells. Mutations in this gene have been associated with Charcot-Marie-Tooth disease, type 4J. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, severe tremors, diluted coat color, neurodegeneration, impaired coordination, muscle weakness, small size and reduced spleen. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(3) Gene trapped(12) Spontaneous(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A G 2: 103,538,563 (GRCm39) probably null Het
Alpk1 T C 3: 127,471,365 (GRCm39) H1039R probably damaging Het
Avpr1a A G 10: 122,285,616 (GRCm39) S303G probably benign Het
Axdnd1 A G 1: 156,246,840 (GRCm39) L79S probably damaging Het
Baz1a A G 12: 54,967,928 (GRCm39) I667T possibly damaging Het
Bend5 A G 4: 111,305,802 (GRCm39) Y282C possibly damaging Het
Clstn3 T C 6: 124,428,327 (GRCm39) D438G probably damaging Het
Cog3 A G 14: 75,980,998 (GRCm39) probably benign Het
Cyp2j6 T C 4: 96,441,525 (GRCm39) N55S probably benign Het
Eif4b G A 15: 101,992,745 (GRCm39) G101R probably damaging Het
Epha2 T C 4: 141,033,861 (GRCm39) L40P probably damaging Het
Hal T C 10: 93,349,888 (GRCm39) probably benign Het
Helz A G 11: 107,576,118 (GRCm39) Y1770C unknown Het
Meis3 A G 7: 15,911,419 (GRCm39) T39A probably benign Het
Nod1 G T 6: 54,921,902 (GRCm39) R139S probably benign Het
Or6n2 A T 1: 173,896,878 (GRCm39) N5Y probably damaging Het
Pacsin3 C T 2: 91,093,286 (GRCm39) probably null Het
Plekhh1 T A 12: 79,100,422 (GRCm39) I130N probably damaging Het
Plxna2 G A 1: 194,428,465 (GRCm39) E512K probably benign Het
Ppp1r9a A G 6: 5,057,531 (GRCm39) I215M probably damaging Het
Ryr3 C G 2: 112,506,218 (GRCm39) R3443P probably damaging Het
Sap130 A T 18: 31,807,435 (GRCm39) H414L possibly damaging Het
Slc33a1 A G 3: 63,871,145 (GRCm39) I156T probably benign Het
Slc37a2 G A 9: 37,146,803 (GRCm39) T338M probably damaging Het
Spinkl T A 18: 44,302,230 (GRCm39) probably null Het
Tmc5 T A 7: 118,251,878 (GRCm39) L657* probably null Het
Tmem217 A G 17: 29,745,677 (GRCm39) S18P probably damaging Het
Trim43a GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT 9: 88,465,042 (GRCm39) probably benign Het
Tubb4a A G 17: 57,387,967 (GRCm39) V353A probably benign Het
Ube3b T C 5: 114,553,741 (GRCm39) F974L probably benign Het
Ubqln5 A G 7: 103,777,678 (GRCm39) L382P probably damaging Het
Ufsp2 T A 8: 46,436,723 (GRCm39) probably null Het
Unkl C T 17: 25,448,303 (GRCm39) T66I probably damaging Het
Xrn2 T A 2: 146,880,109 (GRCm39) N477K probably benign Het
Zfhx4 C T 3: 5,468,418 (GRCm39) P2859S probably benign Het
Zzef1 T C 11: 72,749,208 (GRCm39) S899P probably damaging Het
Zzz3 T C 3: 152,161,499 (GRCm39) Y298H probably damaging Het
Other mutations in Fig4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Fig4 APN 10 41,127,784 (GRCm39) missense probably damaging 0.99
IGL01013:Fig4 APN 10 41,143,782 (GRCm39) missense probably benign 0.00
IGL01066:Fig4 APN 10 41,161,413 (GRCm39) splice site probably benign
IGL01501:Fig4 APN 10 41,146,370 (GRCm39) missense probably benign
IGL01503:Fig4 APN 10 41,132,514 (GRCm39) missense probably benign 0.00
IGL01535:Fig4 APN 10 41,132,490 (GRCm39) missense probably benign 0.00
IGL01733:Fig4 APN 10 41,153,389 (GRCm39) missense possibly damaging 0.49
IGL01782:Fig4 APN 10 41,146,396 (GRCm39) missense probably benign 0.18
IGL01866:Fig4 APN 10 41,108,160 (GRCm39) missense possibly damaging 0.77
IGL01934:Fig4 APN 10 41,104,108 (GRCm39) missense probably benign 0.03
IGL01966:Fig4 APN 10 41,108,098 (GRCm39) splice site probably null
IGL02032:Fig4 APN 10 41,179,002 (GRCm39) missense probably benign 0.00
IGL02225:Fig4 APN 10 41,132,448 (GRCm39) missense probably benign
IGL02345:Fig4 APN 10 41,143,770 (GRCm39) missense probably null 1.00
IGL02532:Fig4 APN 10 41,161,277 (GRCm39) splice site probably benign
IGL02686:Fig4 APN 10 41,140,000 (GRCm39) missense probably damaging 0.99
IGL02965:Fig4 APN 10 41,161,661 (GRCm39) missense probably damaging 0.98
P0021:Fig4 UTSW 10 41,127,821 (GRCm39) missense probably damaging 1.00
R0017:Fig4 UTSW 10 41,149,003 (GRCm39) missense possibly damaging 0.94
R0017:Fig4 UTSW 10 41,149,003 (GRCm39) missense possibly damaging 0.94
R0117:Fig4 UTSW 10 41,106,037 (GRCm39) nonsense probably null
R0144:Fig4 UTSW 10 41,134,045 (GRCm39) missense probably damaging 0.99
R0655:Fig4 UTSW 10 41,161,673 (GRCm39) missense probably damaging 1.00
R0701:Fig4 UTSW 10 41,116,508 (GRCm39) nonsense probably null
R0751:Fig4 UTSW 10 41,148,978 (GRCm39) missense probably damaging 1.00
R1540:Fig4 UTSW 10 41,064,582 (GRCm39) missense possibly damaging 0.60
R1586:Fig4 UTSW 10 41,141,423 (GRCm39) missense probably damaging 0.99
R2916:Fig4 UTSW 10 41,134,071 (GRCm39) missense probably damaging 0.98
R4304:Fig4 UTSW 10 41,132,423 (GRCm39) missense probably benign 0.01
R4586:Fig4 UTSW 10 41,064,628 (GRCm39) missense probably damaging 1.00
R4678:Fig4 UTSW 10 41,148,994 (GRCm39) missense probably benign 0.27
R4858:Fig4 UTSW 10 41,109,586 (GRCm39) missense probably benign 0.00
R5614:Fig4 UTSW 10 41,148,981 (GRCm39) missense probably damaging 0.98
R5896:Fig4 UTSW 10 41,130,881 (GRCm39) missense possibly damaging 0.67
R6126:Fig4 UTSW 10 41,141,443 (GRCm39) missense probably damaging 0.99
R7056:Fig4 UTSW 10 41,096,928 (GRCm39) missense probably benign 0.09
R7350:Fig4 UTSW 10 41,127,752 (GRCm39) missense probably benign 0.03
R7452:Fig4 UTSW 10 41,116,633 (GRCm39) missense possibly damaging 0.88
R7481:Fig4 UTSW 10 41,106,001 (GRCm39) critical splice donor site probably null
R7610:Fig4 UTSW 10 41,129,709 (GRCm39) missense probably damaging 1.00
R7818:Fig4 UTSW 10 41,139,162 (GRCm39) missense probably damaging 0.98
R7830:Fig4 UTSW 10 41,132,462 (GRCm39) missense probably benign 0.00
R8263:Fig4 UTSW 10 41,143,711 (GRCm39) nonsense probably null
R8319:Fig4 UTSW 10 41,139,097 (GRCm39) missense probably damaging 1.00
R8409:Fig4 UTSW 10 41,141,427 (GRCm39) missense probably benign 0.01
R8435:Fig4 UTSW 10 41,161,670 (GRCm39) missense probably benign
R8474:Fig4 UTSW 10 41,108,170 (GRCm39) missense probably benign 0.30
R9086:Fig4 UTSW 10 41,161,399 (GRCm39) missense possibly damaging 0.50
R9131:Fig4 UTSW 10 41,141,407 (GRCm39) missense possibly damaging 0.95
R9248:Fig4 UTSW 10 41,153,478 (GRCm39) missense probably benign
R9401:Fig4 UTSW 10 41,143,733 (GRCm39) missense probably benign
R9564:Fig4 UTSW 10 41,161,387 (GRCm39) missense probably benign 0.20
R9627:Fig4 UTSW 10 41,108,178 (GRCm39) missense probably benign 0.01
R9649:Fig4 UTSW 10 41,143,763 (GRCm39) missense probably benign 0.00
Z1088:Fig4 UTSW 10 41,129,727 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCAGTTCCCCAAGGCAAG -3'
(R):5'- GGAATGGCAGACGCATTCAG -3'

Sequencing Primer
(F):5'- TGACATGGAAGTTAACAGTAGCTC -3'
(R):5'- GGCAGACGCATTCAGATTTAATGC -3'
Posted On 2015-04-17