Incidental Mutation 'R0377:Dntt'
Institutional Source Beutler Lab
Gene Symbol Dntt
Ensembl Gene ENSMUSG00000025014
Gene Namedeoxynucleotidyltransferase, terminal
MMRRC Submission 038583-MU
Accession Numbers

Genbank: NM_009345 ; MGI: 98659

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0377 (G1)
Quality Score225
Status Validated
Chromosomal Location41029275-41059523 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 41047627 bp
Amino Acid Change Tryptophan to Stop codon at position 369 (W369*)
Ref Sequence ENSEMBL: ENSMUSP00000107819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051806] [ENSMUST00000112200]
Predicted Effect probably null
Transcript: ENSMUST00000051806
AA Change: W369*
SMART Domains Protein: ENSMUSP00000062078
Gene: ENSMUSG00000025014
AA Change: W369*

BRCT 29 114 3.05e-9 SMART
POLXc 163 529 5.68e-196 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112200
AA Change: W369*
SMART Domains Protein: ENSMUSP00000107819
Gene: ENSMUSG00000025014
AA Change: W369*

BRCT 29 114 3.05e-9 SMART
POLXc 163 509 1.19e-198 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DNA polymerase type-X family and encodes a template-independent DNA polymerase that catalyzes the addition of deoxynucleotides to the 3'-hydroxyl terminus of oligonucleotide primers. In vivo, the encoded protein is expressed in a restricted population of normal and malignant pre-B and pre-T lymphocytes during early differentiation, where it generates antigen receptor diversity by synthesizing non-germ line elements (N-regions) at the junctions of rearranged Ig heavy chain and T cell receptor gene segments. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in lack of "N" nucleotide insertions at the junctions of immunoglobulin and T cell receptor V(D)J rearrangements. Forced expression of terminal deoxynucleotidyl transferase in fetal thymus leads to decreased gamma-delta T cell number. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 C A 11: 94,375,096 V107F possibly damaging Het
Acad11 T A 9: 104,081,692 probably benign Het
Ache G A 5: 137,290,928 E299K possibly damaging Het
Adam5 T C 8: 24,747,541 T618A probably benign Het
Amigo2 T A 15: 97,246,380 T54S possibly damaging Het
Anapc1 A G 2: 128,641,340 probably null Het
Armc4 G A 18: 7,127,415 R933C probably benign Het
Btaf1 A G 19: 36,989,002 K1057E probably benign Het
Cep55 T A 19: 38,071,889 L396* probably null Het
Cic C A 7: 25,285,799 H1157N probably damaging Het
Cntnap5a A T 1: 116,292,529 T690S probably benign Het
D5Ertd579e A T 5: 36,604,567 C1319S probably benign Het
Dnah6 A G 6: 73,121,992 S2027P possibly damaging Het
Esp18 T A 17: 39,409,944 W27R probably benign Het
Fam227b A T 2: 126,125,000 probably benign Het
Fbxo31 G A 8: 121,559,102 probably benign Het
Gm13547 G A 2: 29,761,791 probably null Het
Gnl2 T A 4: 125,046,382 probably benign Het
Gpx2 G A 12: 76,795,156 Q74* probably null Het
Gucy2c A G 6: 136,750,917 probably null Het
Hoxa5 A T 6: 52,202,646 W250R probably damaging Het
Izumo4 G A 10: 80,702,840 R42H probably damaging Het
Kcnj12 G A 11: 61,069,396 M71I probably benign Het
Kmt2b A T 7: 30,574,193 L2333Q probably damaging Het
Mak T C 13: 41,049,348 E177G probably damaging Het
Map3k7 T A 4: 31,985,731 I218N probably damaging Het
Mark3 T C 12: 111,629,029 L393P probably damaging Het
Msh4 A G 3: 153,896,890 S234P probably benign Het
Mug1 A G 6: 121,857,361 D367G probably benign Het
Mypn A G 10: 63,127,622 probably benign Het
Ncapg T C 5: 45,693,817 V784A probably benign Het
Nutf2 T A 8: 105,878,872 V113D probably damaging Het
Olfr1080 A T 2: 86,553,583 D180E probably damaging Het
Opn3 T C 1: 175,663,694 M258V probably damaging Het
Osbpl7 A G 11: 97,055,934 D211G probably damaging Het
Pcnx C T 12: 81,974,579 probably benign Het
Plekhd1 G A 12: 80,706,436 probably benign Het
Pnpla6 A G 8: 3,541,501 E1165G probably damaging Het
Prkab2 T A 3: 97,662,317 D66E probably benign Het
Prpsap2 A G 11: 61,741,000 I177T possibly damaging Het
Ptpn23 A T 9: 110,388,132 S885R possibly damaging Het
Rab26 A T 17: 24,530,045 probably benign Het
Rab5a G A 17: 53,500,462 M175I probably benign Het
Rassf9 T A 10: 102,545,649 D297E probably benign Het
Rimbp2 C T 5: 128,803,861 R161Q probably damaging Het
Rtp1 A G 16: 23,431,284 Y133C probably damaging Het
Sdr16c5 G A 4: 4,005,546 L263F probably benign Het
Sec14l1 T G 11: 117,149,140 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spaca1 T C 4: 34,044,267 probably null Het
Stk36 C T 1: 74,612,730 P394L probably benign Het
Stk4 T C 2: 164,096,800 I196T probably damaging Het
Sult1b1 A T 5: 87,517,376 M233K probably damaging Het
Tmem8b C T 4: 43,674,005 T212M probably damaging Het
Tmprss11g A T 5: 86,490,751 F293I probably damaging Het
Tnfsf11 T G 14: 78,299,912 T104P probably benign Het
Trmt2a G A 16: 18,249,703 R80Q possibly damaging Het
Trps1 C A 15: 50,831,778 E324* probably null Het
U2surp C T 9: 95,484,443 V470I probably benign Het
Wdr18 G A 10: 79,967,502 R400H probably benign Het
Wdr78 A G 4: 103,048,259 V775A probably damaging Het
Zfp119b T A 17: 55,938,671 H505L probably damaging Het
Zfp619 T A 7: 39,536,797 C750* probably null Het
Zfr T C 15: 12,160,591 I750T probably benign Het
Other mutations in Dntt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Dntt APN 19 41039823 missense probably benign 0.01
IGL01531:Dntt APN 19 41053238 nonsense probably null
IGL01859:Dntt APN 19 41037304 missense probably benign
IGL02053:Dntt APN 19 41046274 missense probably benign 0.00
IGL02411:Dntt APN 19 41052985 splice site probably null
IGL03180:Dntt APN 19 41029551 missense probably benign 0.09
R0106:Dntt UTSW 19 41055746 splice site probably benign
R0122:Dntt UTSW 19 41053038 missense possibly damaging 0.95
R0194:Dntt UTSW 19 41038970 missense possibly damaging 0.90
R0266:Dntt UTSW 19 41059127 missense probably damaging 0.99
R0412:Dntt UTSW 19 41042933 missense probably damaging 1.00
R0604:Dntt UTSW 19 41053149 missense probably benign 0.01
R1350:Dntt UTSW 19 41037139 splice site probably benign
R1577:Dntt UTSW 19 41055785 missense probably damaging 1.00
R1677:Dntt UTSW 19 41029484 missense probably benign 0.26
R2567:Dntt UTSW 19 41041336 missense possibly damaging 0.81
R4380:Dntt UTSW 19 41053233 missense probably damaging 1.00
R4703:Dntt UTSW 19 41039803 missense probably benign 0.00
R4999:Dntt UTSW 19 41039856 missense probably damaging 0.99
R6257:Dntt UTSW 19 41053062 missense probably damaging 1.00
R6757:Dntt UTSW 19 41037162 missense probably damaging 1.00
R7340:Dntt UTSW 19 41058565 critical splice acceptor site probably null
R7388:Dntt UTSW 19 41038979 missense probably benign 0.01
R7553:Dntt UTSW 19 41029487 missense probably damaging 0.99
R7806:Dntt UTSW 19 41029632 missense probably benign 0.02
R8145:Dntt UTSW 19 41055785 missense probably damaging 1.00
YA93:Dntt UTSW 19 41053187 missense probably benign
Z1177:Dntt UTSW 19 41055815 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cataacaaacacatcacacacac -3'
Posted On2013-04-24