Incidental Mutation 'R3928:Tdrd5'
ID308353
Institutional Source Beutler Lab
Gene Symbol Tdrd5
Ensembl Gene ENSMUSG00000060985
Gene Nametudor domain containing 5
Synonyms
MMRRC Submission 040823-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R3928 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location156255296-156303664 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156300778 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 136 (T136I)
Ref Sequence ENSEMBL: ENSMUSP00000137182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121146] [ENSMUST00000141760] [ENSMUST00000167528]
Predicted Effect probably benign
Transcript: ENSMUST00000121146
AA Change: T213I

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137298
Gene: ENSMUSG00000060985
AA Change: T213I

DomainStartEndE-ValueType
Pfam:OST-HTH 6 76 3.7e-11 PFAM
Pfam:OST-HTH 126 194 1.5e-10 PFAM
Pfam:OST-HTH 290 361 7.4e-10 PFAM
TUDOR 532 590 3.25e-7 SMART
low complexity region 739 753 N/A INTRINSIC
low complexity region 1001 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141760
SMART Domains Protein: ENSMUSP00000137156
Gene: ENSMUSG00000060985

DomainStartEndE-ValueType
Pfam:OST-HTH 6 75 2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167528
AA Change: T136I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000137182
Gene: ENSMUSG00000060985
AA Change: T136I

DomainStartEndE-ValueType
Pfam:OST-HTH 6 75 1.4e-9 PFAM
Pfam:OST-HTH 213 284 6.4e-9 PFAM
TUDOR 455 513 3.25e-7 SMART
low complexity region 662 676 N/A INTRINSIC
low complexity region 924 944 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195064
Meta Mutation Damage Score 0.1501 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with defective spermatid elongation, occasional arrested male meiosis, and apoptosis of male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,468,735 H181Q probably benign Het
Atrx T C X: 105,879,917 I157V possibly damaging Het
Birc6 A G 17: 74,611,175 D1856G possibly damaging Het
Birc6 A G 17: 74,638,409 T2811A probably damaging Het
Brsk2 T C 7: 141,998,418 F108S probably damaging Het
Clasp2 C A 9: 113,906,105 H1004N probably benign Het
Cntd1 G A 11: 101,287,519 V315I probably benign Het
Col13a1 A G 10: 61,867,525 probably benign Het
Ctps T A 4: 120,541,896 H553L probably benign Het
Dpysl2 A G 14: 66,824,431 I242T possibly damaging Het
Exoc3l C T 8: 105,290,917 probably benign Het
Fam229a A G 4: 129,491,411 probably benign Het
Fshr C T 17: 88,985,534 R572H probably damaging Het
Gm5501 A G 18: 9,917,267 noncoding transcript Het
Gmpr A G 13: 45,529,747 I165V probably benign Het
Gnat3 G A 5: 18,003,894 probably benign Het
H1foo A G 6: 115,948,796 K185E probably benign Het
H2-Q4 T G 17: 35,379,690 L16R unknown Het
Hs2st1 T C 3: 144,434,628 K311E possibly damaging Het
Kcnj15 A G 16: 95,296,509 E330G possibly damaging Het
Kif3a A G 11: 53,570,614 K29E probably benign Het
Krtap4-1 A G 11: 99,628,157 V9A unknown Het
Lmntd2 C T 7: 141,211,204 G432S probably damaging Het
Me3 T C 7: 89,833,690 probably benign Het
Myo1d G T 11: 80,484,261 R996S probably benign Het
Myo9a T A 9: 59,895,283 W2018R probably damaging Het
Nphp3 G T 9: 104,011,730 V265F probably damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr492 A G 7: 108,323,025 I217T probably benign Het
Olfr894 T C 9: 38,218,835 M1T probably null Het
Pgp A G 17: 24,471,341 E247G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plch1 G A 3: 63,767,623 A202V probably damaging Het
Rbm11 G A 16: 75,593,044 probably null Het
Scg5 T C 2: 113,791,885 K124R probably damaging Het
Serpina3j A T 12: 104,319,657 H357L probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Tdpoz3 T C 3: 93,826,909 I297T possibly damaging Het
Tfcp2l1 T A 1: 118,669,476 I429K possibly damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Top1 T C 2: 160,687,749 probably benign Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Trmo C T 4: 46,382,647 G150S probably damaging Het
Vmn1r183 T C 7: 24,055,572 S267P probably damaging Het
Xirp2 T A 2: 67,511,669 F1418Y possibly damaging Het
Zfp114 T C 7: 24,181,042 V271A possibly damaging Het
Zfp710 A G 7: 80,081,386 R104G probably damaging Het
Other mutations in Tdrd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Tdrd5 APN 1 156301827 missense probably benign 0.32
IGL02441:Tdrd5 APN 1 156259943 splice site probably benign
IGL02932:Tdrd5 APN 1 156270620 missense possibly damaging 0.52
R0049:Tdrd5 UTSW 1 156301903 missense probably damaging 1.00
R0416:Tdrd5 UTSW 1 156285481 missense probably damaging 0.96
R0518:Tdrd5 UTSW 1 156262941 missense probably damaging 0.99
R1439:Tdrd5 UTSW 1 156277487 missense probably damaging 1.00
R1454:Tdrd5 UTSW 1 156259836 missense probably benign 0.41
R1497:Tdrd5 UTSW 1 156255802 missense probably benign 0.28
R1774:Tdrd5 UTSW 1 156277509 missense probably damaging 1.00
R2101:Tdrd5 UTSW 1 156301639 missense probably damaging 1.00
R2125:Tdrd5 UTSW 1 156276573 missense probably damaging 0.99
R2126:Tdrd5 UTSW 1 156276573 missense probably damaging 0.99
R2197:Tdrd5 UTSW 1 156259865 missense probably benign 0.02
R3820:Tdrd5 UTSW 1 156285483 missense probably benign 0.16
R4258:Tdrd5 UTSW 1 156259742 missense probably benign 0.00
R4502:Tdrd5 UTSW 1 156300764 missense probably benign 0.00
R4601:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4602:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4610:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4611:Tdrd5 UTSW 1 156284374 missense probably benign 0.12
R4674:Tdrd5 UTSW 1 156277435 missense probably damaging 1.00
R4722:Tdrd5 UTSW 1 156302375 missense probably benign 0.31
R4778:Tdrd5 UTSW 1 156255587 missense probably damaging 0.98
R5737:Tdrd5 UTSW 1 156300724 missense probably benign 0.01
R5881:Tdrd5 UTSW 1 156294500 missense probably damaging 0.98
R5900:Tdrd5 UTSW 1 156277435 nonsense probably null
R6234:Tdrd5 UTSW 1 156293377 missense possibly damaging 0.93
R6557:Tdrd5 UTSW 1 156300721 missense probably benign 0.10
R7068:Tdrd5 UTSW 1 156284271 missense probably damaging 1.00
R7184:Tdrd5 UTSW 1 156259935 missense probably benign 0.30
R7199:Tdrd5 UTSW 1 156301723 missense probably damaging 0.98
R7432:Tdrd5 UTSW 1 156302432 missense probably damaging 1.00
R7469:Tdrd5 UTSW 1 156262905 missense probably benign 0.00
R8030:Tdrd5 UTSW 1 156270595 nonsense probably null
X0026:Tdrd5 UTSW 1 156285427 missense probably benign 0.01
Z1176:Tdrd5 UTSW 1 156255699 missense not run
Z1177:Tdrd5 UTSW 1 156255629 missense not run
Z1177:Tdrd5 UTSW 1 156302586 missense not run
Z1177:Tdrd5 UTSW 1 156302588 missense not run
Predicted Primers PCR Primer
(F):5'- CAGTGTGGTTCAGCCTTGAAG -3'
(R):5'- AAACTGCTTGGTTGGGCACTC -3'

Sequencing Primer
(F):5'- GCCTCCACAGAATTAAACGTGGG -3'
(R):5'- GAGCAACAGTCTTTTCAGTAACATGG -3'
Posted On2015-04-17