Incidental Mutation 'R3928:Tdpoz3'
ID308358
Institutional Source Beutler Lab
Gene Symbol Tdpoz3
Ensembl Gene ENSMUSG00000058005
Gene NameTD and POZ domain containing 3
Synonyms
MMRRC Submission 040823-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.838) question?
Stock #R3928 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location93826020-93827117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93826909 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 297 (I297T)
Ref Sequence ENSEMBL: ENSMUSP00000080472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081780]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081780
AA Change: I297T

PolyPhen 2 Score 0.483 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080472
Gene: ENSMUSG00000058005
AA Change: I297T

DomainStartEndE-ValueType
MATH 24 130 1.72e-3 SMART
BTB 188 287 3.98e-24 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,468,735 H181Q probably benign Het
Atrx T C X: 105,879,917 I157V possibly damaging Het
Birc6 A G 17: 74,611,175 D1856G possibly damaging Het
Birc6 A G 17: 74,638,409 T2811A probably damaging Het
Brsk2 T C 7: 141,998,418 F108S probably damaging Het
Clasp2 C A 9: 113,906,105 H1004N probably benign Het
Cntd1 G A 11: 101,287,519 V315I probably benign Het
Col13a1 A G 10: 61,867,525 probably benign Het
Ctps T A 4: 120,541,896 H553L probably benign Het
Dpysl2 A G 14: 66,824,431 I242T possibly damaging Het
Exoc3l C T 8: 105,290,917 probably benign Het
Fam229a A G 4: 129,491,411 probably benign Het
Fshr C T 17: 88,985,534 R572H probably damaging Het
Gm5501 A G 18: 9,917,267 noncoding transcript Het
Gmpr A G 13: 45,529,747 I165V probably benign Het
Gnat3 G A 5: 18,003,894 probably benign Het
H1foo A G 6: 115,948,796 K185E probably benign Het
H2-Q4 T G 17: 35,379,690 L16R unknown Het
Hs2st1 T C 3: 144,434,628 K311E possibly damaging Het
Kcnj15 A G 16: 95,296,509 E330G possibly damaging Het
Kif3a A G 11: 53,570,614 K29E probably benign Het
Krtap4-1 A G 11: 99,628,157 V9A unknown Het
Lmntd2 C T 7: 141,211,204 G432S probably damaging Het
Me3 T C 7: 89,833,690 probably benign Het
Myo1d G T 11: 80,484,261 R996S probably benign Het
Myo9a T A 9: 59,895,283 W2018R probably damaging Het
Nphp3 G T 9: 104,011,730 V265F probably damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr492 A G 7: 108,323,025 I217T probably benign Het
Olfr894 T C 9: 38,218,835 M1T probably null Het
Pgp A G 17: 24,471,341 E247G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plch1 G A 3: 63,767,623 A202V probably damaging Het
Rbm11 G A 16: 75,593,044 probably null Het
Scg5 T C 2: 113,791,885 K124R probably damaging Het
Serpina3j A T 12: 104,319,657 H357L probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Tdrd5 G A 1: 156,300,778 T136I probably benign Het
Tfcp2l1 T A 1: 118,669,476 I429K possibly damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Top1 T C 2: 160,687,749 probably benign Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Trmo C T 4: 46,382,647 G150S probably damaging Het
Vmn1r183 T C 7: 24,055,572 S267P probably damaging Het
Xirp2 T A 2: 67,511,669 F1418Y possibly damaging Het
Zfp114 T C 7: 24,181,042 V271A possibly damaging Het
Zfp710 A G 7: 80,081,386 R104G probably damaging Het
Other mutations in Tdpoz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03008:Tdpoz3 APN 3 93826335 nonsense probably null
FR4342:Tdpoz3 UTSW 3 93826512 missense probably benign 0.09
FR4737:Tdpoz3 UTSW 3 93826674 missense probably benign
R0270:Tdpoz3 UTSW 3 93826924 missense probably benign 0.00
R0401:Tdpoz3 UTSW 3 93826365 missense probably benign 0.00
R0961:Tdpoz3 UTSW 3 93826881 missense probably benign 0.13
R1381:Tdpoz3 UTSW 3 93826140 missense probably benign 0.04
R1615:Tdpoz3 UTSW 3 93826311 missense probably benign 0.01
R2142:Tdpoz3 UTSW 3 93826899 missense probably benign 0.02
R2156:Tdpoz3 UTSW 3 93826780 missense probably damaging 1.00
R2872:Tdpoz3 UTSW 3 93826428 missense probably benign 0.01
R2872:Tdpoz3 UTSW 3 93826428 missense probably benign 0.01
R4011:Tdpoz3 UTSW 3 93826243 missense possibly damaging 0.71
R4611:Tdpoz3 UTSW 3 93827023 missense probably damaging 0.97
R4747:Tdpoz3 UTSW 3 93826169 missense possibly damaging 0.63
R4934:Tdpoz3 UTSW 3 93826980 missense probably benign 0.03
R5090:Tdpoz3 UTSW 3 93826563 missense possibly damaging 0.82
R5389:Tdpoz3 UTSW 3 93826872 missense probably benign 0.08
R6909:Tdpoz3 UTSW 3 93826465 missense probably damaging 1.00
R7095:Tdpoz3 UTSW 3 93827061 missense probably benign 0.16
R7152:Tdpoz3 UTSW 3 93826465 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGGACCTGGATCTTGATG -3'
(R):5'- GCTGGCTAGATTCTAAGACCAC -3'

Sequencing Primer
(F):5'- ACCTGGATCTTGATGTCTTTAAGGAG -3'
(R):5'- CTGGCTAGATTCTAAGACCACATTTG -3'
Posted On2015-04-17