Incidental Mutation 'R3928:Trmo'
ID308360
Institutional Source Beutler Lab
Gene Symbol Trmo
Ensembl Gene ENSMUSG00000028331
Gene NametRNA methyltransferase O
Synonyms5830415F09Rik
MMRRC Submission 040823-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3928 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location46376505-46389437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46382647 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 150 (G150S)
Ref Sequence ENSEMBL: ENSMUSP00000083752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030015] [ENSMUST00000086563] [ENSMUST00000151903]
Predicted Effect probably damaging
Transcript: ENSMUST00000030015
AA Change: G150S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030015
Gene: ENSMUSG00000028331
AA Change: G150S

DomainStartEndE-ValueType
Pfam:UPF0066 42 165 2.3e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086563
AA Change: G150S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083752
Gene: ENSMUSG00000028331
AA Change: G150S

DomainStartEndE-ValueType
Pfam:UPF0066 44 164 1.2e-46 PFAM
low complexity region 431 442 N/A INTRINSIC
low complexity region 443 456 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151903
AA Change: G157S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119785
Gene: ENSMUSG00000028331
AA Change: G157S

DomainStartEndE-ValueType
Pfam:UPF0066 49 172 4.1e-45 PFAM
Meta Mutation Damage Score 0.5877 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,468,735 H181Q probably benign Het
Atrx T C X: 105,879,917 I157V possibly damaging Het
Birc6 A G 17: 74,611,175 D1856G possibly damaging Het
Birc6 A G 17: 74,638,409 T2811A probably damaging Het
Brsk2 T C 7: 141,998,418 F108S probably damaging Het
Clasp2 C A 9: 113,906,105 H1004N probably benign Het
Cntd1 G A 11: 101,287,519 V315I probably benign Het
Col13a1 A G 10: 61,867,525 probably benign Het
Ctps T A 4: 120,541,896 H553L probably benign Het
Dpysl2 A G 14: 66,824,431 I242T possibly damaging Het
Exoc3l C T 8: 105,290,917 probably benign Het
Fam229a A G 4: 129,491,411 probably benign Het
Fshr C T 17: 88,985,534 R572H probably damaging Het
Gm5501 A G 18: 9,917,267 noncoding transcript Het
Gmpr A G 13: 45,529,747 I165V probably benign Het
Gnat3 G A 5: 18,003,894 probably benign Het
H1foo A G 6: 115,948,796 K185E probably benign Het
H2-Q4 T G 17: 35,379,690 L16R unknown Het
Hs2st1 T C 3: 144,434,628 K311E possibly damaging Het
Kcnj15 A G 16: 95,296,509 E330G possibly damaging Het
Kif3a A G 11: 53,570,614 K29E probably benign Het
Krtap4-1 A G 11: 99,628,157 V9A unknown Het
Lmntd2 C T 7: 141,211,204 G432S probably damaging Het
Me3 T C 7: 89,833,690 probably benign Het
Myo1d G T 11: 80,484,261 R996S probably benign Het
Myo9a T A 9: 59,895,283 W2018R probably damaging Het
Nphp3 G T 9: 104,011,730 V265F probably damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr492 A G 7: 108,323,025 I217T probably benign Het
Olfr894 T C 9: 38,218,835 M1T probably null Het
Pgp A G 17: 24,471,341 E247G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plch1 G A 3: 63,767,623 A202V probably damaging Het
Rbm11 G A 16: 75,593,044 probably null Het
Scg5 T C 2: 113,791,885 K124R probably damaging Het
Serpina3j A T 12: 104,319,657 H357L probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Tdpoz3 T C 3: 93,826,909 I297T possibly damaging Het
Tdrd5 G A 1: 156,300,778 T136I probably benign Het
Tfcp2l1 T A 1: 118,669,476 I429K possibly damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Top1 T C 2: 160,687,749 probably benign Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Vmn1r183 T C 7: 24,055,572 S267P probably damaging Het
Xirp2 T A 2: 67,511,669 F1418Y possibly damaging Het
Zfp114 T C 7: 24,181,042 V271A possibly damaging Het
Zfp710 A G 7: 80,081,386 R104G probably damaging Het
Other mutations in Trmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Trmo APN 4 46382490 missense probably benign
IGL01296:Trmo APN 4 46387589 missense probably damaging 1.00
IGL01308:Trmo APN 4 46377053 utr 3 prime probably benign
IGL01544:Trmo APN 4 46386169 missense probably damaging 1.00
IGL01545:Trmo APN 4 46386169 missense probably damaging 1.00
IGL01722:Trmo APN 4 46386092 critical splice donor site probably null
IGL02085:Trmo APN 4 46380217 missense probably damaging 1.00
IGL02927:Trmo APN 4 46387602 missense probably damaging 1.00
R0645:Trmo UTSW 4 46377083 utr 3 prime probably benign
R0745:Trmo UTSW 4 46382104 missense probably damaging 1.00
R1365:Trmo UTSW 4 46380278 missense probably damaging 1.00
R1835:Trmo UTSW 4 46380158 missense probably damaging 1.00
R3929:Trmo UTSW 4 46382647 missense probably damaging 1.00
R4497:Trmo UTSW 4 46382140 missense probably damaging 1.00
R4938:Trmo UTSW 4 46382388 missense probably benign 0.00
R4980:Trmo UTSW 4 46389364 nonsense probably null
R5209:Trmo UTSW 4 46387740 missense probably damaging 0.99
R5639:Trmo UTSW 4 46382073 missense probably benign 0.00
R5855:Trmo UTSW 4 46382568 missense probably benign 0.43
R6151:Trmo UTSW 4 46389390 missense probably damaging 1.00
R7351:Trmo UTSW 4 46387716 missense possibly damaging 0.78
R8684:Trmo UTSW 4 46386251 nonsense probably null
R8684:Trmo UTSW 4 46386253 critical splice acceptor site probably null
R8823:Trmo UTSW 4 46382604 missense probably damaging 1.00
R8856:Trmo UTSW 4 46387625 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGGCGAGGCTGTACTTTC -3'
(R):5'- ATGACGTGTTCTATGAGAGCCTTG -3'

Sequencing Primer
(F):5'- GAGGCTGTACTTTCCCACG -3'
(R):5'- ACGTGTTCTATGAGAGCCTTGAAGAG -3'
Posted On2015-04-17