Incidental Mutation 'R3928:Ctps'
ID308362
Institutional Source Beutler Lab
Gene Symbol Ctps
Ensembl Gene ENSMUSG00000028633
Gene Namecytidine 5'-triphosphate synthase
Synonyms
MMRRC Submission 040823-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R3928 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location120539868-120570276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120541896 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 553 (H553L)
Ref Sequence ENSEMBL: ENSMUSP00000030381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030381]
Predicted Effect probably benign
Transcript: ENSMUST00000030381
AA Change: H553L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030381
Gene: ENSMUSG00000028633
AA Change: H553L

DomainStartEndE-ValueType
Pfam:CTP_synth_N 2 277 2.8e-135 PFAM
Pfam:GATase 309 546 6.7e-55 PFAM
Pfam:Peptidase_C26 378 528 3.8e-10 PFAM
low complexity region 565 578 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147980
Meta Mutation Damage Score 0.0836 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme responsible for the catalytic conversion of UTP (uridine triphosphate) to CTP (cytidine triphospate). This reaction is an important step in the biosynthesis of phospholipids and nucleic acids. Activity of this proten is important in the immune system, and loss of function of this gene has been associated with immunodeficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,468,735 H181Q probably benign Het
Atrx T C X: 105,879,917 I157V possibly damaging Het
Birc6 A G 17: 74,611,175 D1856G possibly damaging Het
Birc6 A G 17: 74,638,409 T2811A probably damaging Het
Brsk2 T C 7: 141,998,418 F108S probably damaging Het
Clasp2 C A 9: 113,906,105 H1004N probably benign Het
Cntd1 G A 11: 101,287,519 V315I probably benign Het
Col13a1 A G 10: 61,867,525 probably benign Het
Dpysl2 A G 14: 66,824,431 I242T possibly damaging Het
Exoc3l C T 8: 105,290,917 probably benign Het
Fam229a A G 4: 129,491,411 probably benign Het
Fshr C T 17: 88,985,534 R572H probably damaging Het
Gm5501 A G 18: 9,917,267 noncoding transcript Het
Gmpr A G 13: 45,529,747 I165V probably benign Het
Gnat3 G A 5: 18,003,894 probably benign Het
H1foo A G 6: 115,948,796 K185E probably benign Het
H2-Q4 T G 17: 35,379,690 L16R unknown Het
Hs2st1 T C 3: 144,434,628 K311E possibly damaging Het
Kcnj15 A G 16: 95,296,509 E330G possibly damaging Het
Kif3a A G 11: 53,570,614 K29E probably benign Het
Krtap4-1 A G 11: 99,628,157 V9A unknown Het
Lmntd2 C T 7: 141,211,204 G432S probably damaging Het
Me3 T C 7: 89,833,690 probably benign Het
Myo1d G T 11: 80,484,261 R996S probably benign Het
Myo9a T A 9: 59,895,283 W2018R probably damaging Het
Nphp3 G T 9: 104,011,730 V265F probably damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr492 A G 7: 108,323,025 I217T probably benign Het
Olfr894 T C 9: 38,218,835 M1T probably null Het
Pgp A G 17: 24,471,341 E247G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plch1 G A 3: 63,767,623 A202V probably damaging Het
Rbm11 G A 16: 75,593,044 probably null Het
Scg5 T C 2: 113,791,885 K124R probably damaging Het
Serpina3j A T 12: 104,319,657 H357L probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Tdpoz3 T C 3: 93,826,909 I297T possibly damaging Het
Tdrd5 G A 1: 156,300,778 T136I probably benign Het
Tfcp2l1 T A 1: 118,669,476 I429K possibly damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Top1 T C 2: 160,687,749 probably benign Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Trmo C T 4: 46,382,647 G150S probably damaging Het
Vmn1r183 T C 7: 24,055,572 S267P probably damaging Het
Xirp2 T A 2: 67,511,669 F1418Y possibly damaging Het
Zfp114 T C 7: 24,181,042 V271A possibly damaging Het
Zfp710 A G 7: 80,081,386 R104G probably damaging Het
Other mutations in Ctps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Ctps APN 4 120552944 missense probably damaging 1.00
IGL00919:Ctps APN 4 120567348 missense probably benign 0.03
IGL01510:Ctps APN 4 120558844 missense probably damaging 0.98
IGL01686:Ctps APN 4 120553986 missense probably benign
IGL01897:Ctps APN 4 120567279 missense probably damaging 1.00
IGL02261:Ctps APN 4 120542579 missense possibly damaging 0.53
IGL02797:Ctps APN 4 120562824 missense probably benign 0.03
R0125:Ctps UTSW 4 120561525 splice site probably benign
R1053:Ctps UTSW 4 120543722 splice site probably null
R2087:Ctps UTSW 4 120562815 missense probably benign 0.12
R3736:Ctps UTSW 4 120543746 missense probably benign
R3929:Ctps UTSW 4 120541896 missense probably benign
R4193:Ctps UTSW 4 120548138 missense probably damaging 1.00
R4389:Ctps UTSW 4 120558790 missense probably damaging 1.00
R4853:Ctps UTSW 4 120554010 missense probably damaging 1.00
R5045:Ctps UTSW 4 120552878 critical splice donor site probably null
R5074:Ctps UTSW 4 120553973 missense probably damaging 1.00
R5566:Ctps UTSW 4 120554103 splice site probably null
R6235:Ctps UTSW 4 120558806 missense probably benign 0.42
R6828:Ctps UTSW 4 120548138 missense probably damaging 1.00
R7232:Ctps UTSW 4 120548124 missense probably damaging 1.00
R7487:Ctps UTSW 4 120558800 missense probably damaging 1.00
X0027:Ctps UTSW 4 120554093 missense probably damaging 1.00
X0062:Ctps UTSW 4 120542617 missense probably benign
Z1176:Ctps UTSW 4 120542743 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCCTGGCCAGCAAGATAG -3'
(R):5'- TGTAGCAGTGTCAGCTGACTCC -3'

Sequencing Primer
(F):5'- GATAGGGGCAGCCTAACAAC -3'
(R):5'- TAGCAGTGTCAGCTGACTCCTTTTC -3'
Posted On2015-04-17