Incidental Mutation 'R3928:Gnat3'
ID308364
Institutional Source Beutler Lab
Gene Symbol Gnat3
Ensembl Gene ENSMUSG00000028777
Gene Nameguanine nucleotide binding protein, alpha transducing 3
SynonymsGtn, Ggust, alpha-gustducin
MMRRC Submission 040823-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3928 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location17962549-18019834 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 18003894 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030561]
Predicted Effect probably benign
Transcript: ENSMUST00000030561
SMART Domains Protein: ENSMUSP00000030561
Gene: ENSMUSG00000028777

DomainStartEndE-ValueType
G_alpha 13 353 3.06e-221 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sweet, bitter, and umami tastes are transmitted from taste receptors by a specific guanine nucleotide binding protein. The protein encoded by this gene is the alpha subunit of this heterotrimeric G protein, which is found not only in the oral epithelium but also in gut tissues. Variations in this gene have been linked to metabolic syndrome. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal taste sensitivity. Mice show reduced behavioral and electrophysiological responses to bitter, sweet, and unami compounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,468,735 H181Q probably benign Het
Atrx T C X: 105,879,917 I157V possibly damaging Het
Birc6 A G 17: 74,611,175 D1856G possibly damaging Het
Birc6 A G 17: 74,638,409 T2811A probably damaging Het
Brsk2 T C 7: 141,998,418 F108S probably damaging Het
Clasp2 C A 9: 113,906,105 H1004N probably benign Het
Cntd1 G A 11: 101,287,519 V315I probably benign Het
Col13a1 A G 10: 61,867,525 probably benign Het
Ctps T A 4: 120,541,896 H553L probably benign Het
Dpysl2 A G 14: 66,824,431 I242T possibly damaging Het
Exoc3l C T 8: 105,290,917 probably benign Het
Fam229a A G 4: 129,491,411 probably benign Het
Fshr C T 17: 88,985,534 R572H probably damaging Het
Gm5501 A G 18: 9,917,267 noncoding transcript Het
Gmpr A G 13: 45,529,747 I165V probably benign Het
H1foo A G 6: 115,948,796 K185E probably benign Het
H2-Q4 T G 17: 35,379,690 L16R unknown Het
Hs2st1 T C 3: 144,434,628 K311E possibly damaging Het
Kcnj15 A G 16: 95,296,509 E330G possibly damaging Het
Kif3a A G 11: 53,570,614 K29E probably benign Het
Krtap4-1 A G 11: 99,628,157 V9A unknown Het
Lmntd2 C T 7: 141,211,204 G432S probably damaging Het
Me3 T C 7: 89,833,690 probably benign Het
Myo1d G T 11: 80,484,261 R996S probably benign Het
Myo9a T A 9: 59,895,283 W2018R probably damaging Het
Nphp3 G T 9: 104,011,730 V265F probably damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr492 A G 7: 108,323,025 I217T probably benign Het
Olfr894 T C 9: 38,218,835 M1T probably null Het
Pgp A G 17: 24,471,341 E247G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plch1 G A 3: 63,767,623 A202V probably damaging Het
Rbm11 G A 16: 75,593,044 probably null Het
Scg5 T C 2: 113,791,885 K124R probably damaging Het
Serpina3j A T 12: 104,319,657 H357L probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Tdpoz3 T C 3: 93,826,909 I297T possibly damaging Het
Tdrd5 G A 1: 156,300,778 T136I probably benign Het
Tfcp2l1 T A 1: 118,669,476 I429K possibly damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Top1 T C 2: 160,687,749 probably benign Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Trmo C T 4: 46,382,647 G150S probably damaging Het
Vmn1r183 T C 7: 24,055,572 S267P probably damaging Het
Xirp2 T A 2: 67,511,669 F1418Y possibly damaging Het
Zfp114 T C 7: 24,181,042 V271A possibly damaging Het
Zfp710 A G 7: 80,081,386 R104G probably damaging Het
Other mutations in Gnat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Gnat3 APN 5 18003751 splice site probably benign
IGL01023:Gnat3 APN 5 18003828 missense probably damaging 1.00
IGL01997:Gnat3 APN 5 17999723 nonsense probably null
PIT4377001:Gnat3 UTSW 5 18015559 missense
R0556:Gnat3 UTSW 5 18019598 missense probably damaging 1.00
R1624:Gnat3 UTSW 5 18003843 missense possibly damaging 0.66
R1934:Gnat3 UTSW 5 18019510 missense possibly damaging 0.74
R2319:Gnat3 UTSW 5 18019626 missense probably benign 0.17
R4169:Gnat3 UTSW 5 18003864 missense probably damaging 1.00
R4420:Gnat3 UTSW 5 17999801 missense probably damaging 1.00
R4632:Gnat3 UTSW 5 18015366 splice site probably null
R4651:Gnat3 UTSW 5 18015570 missense probably damaging 1.00
R4652:Gnat3 UTSW 5 18015570 missense probably damaging 1.00
R5471:Gnat3 UTSW 5 17991324 missense probably damaging 1.00
R7460:Gnat3 UTSW 5 17999658 missense
R7627:Gnat3 UTSW 5 17999748 missense
R7637:Gnat3 UTSW 5 18003772 missense
X0064:Gnat3 UTSW 5 18003840 missense possibly damaging 0.74
Z1088:Gnat3 UTSW 5 18015323 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCATCAGATCAGTAGCATG -3'
(R):5'- TTGTTTGAGAAATGCAGCCTAG -3'

Sequencing Primer
(F):5'- TGCAGTGTATCCGATGTAAAGTC -3'
(R):5'- CCTAGAAGGAAGGACAGGCTC -3'
Posted On2015-04-17