Mutagenetix > Incidental Mutations

Incidental Mutation 'R3928:Exoc3l'

308374

Institutional Source

Beutler Lab

Gene Symbol

Exoc3l

Ensembl Gene

ENSMUSG00000043251

Gene Name

exocyst complex component 3-like

Synonyms

C730015A04Rik

MMRRC Submission

040823-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.207) question?

Stock #

R3928 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105289924-105296101 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

C to T at 105290917 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014981] [ENSMUST00000057855] [ENSMUST00000171788] [ENSMUST00000212219] [ENSMUST00000212777] [ENSMUST00000212922]

Predicted Effect

probably benign
Transcript: ENSMUST00000014981

SMART Domains

Protein: ENSMUSP00000014981
Gene: ENSMUSG00000014837

Domain	Start	End	E-Value	Type
DUF1704	148	457	1.07e-139	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000057855

SMART Domains

Protein: ENSMUSP00000053766
Gene: ENSMUSG00000043251

Domain	Start	End	E-Value	Type
Pfam:Sec6	189	722	5.4e-116	PFAM
low complexity region	723	739	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171788

SMART Domains

Protein: ENSMUSP00000128530
Gene: ENSMUSG00000014837

Domain	Start	End	E-Value	Type
DUF1704	148	457	1.07e-139	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212138

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212215

Predicted Effect

probably benign
Transcript: ENSMUST00000212219

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212232

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212261

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212288

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212359

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212529

Predicted Effect

probably benign
Transcript: ENSMUST00000212777

Predicted Effect

probably benign
Transcript: ENSMUST00000212922

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212974

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (48/48)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abr	A	T	11: 76,468,735	H181Q	probably benign	Het
Atrx	T	C	X: 105,879,917	I157V	possibly damaging	Het
Birc6	A	G	17: 74,611,175	D1856G	possibly damaging	Het
Birc6	A	G	17: 74,638,409	T2811A	probably damaging	Het
Brsk2	T	C	7: 141,998,418	F108S	probably damaging	Het
Clasp2	C	A	9: 113,906,105	H1004N	probably benign	Het
Cntd1	G	A	11: 101,287,519	V315I	probably benign	Het
Col13a1	A	G	10: 61,867,525		probably benign	Het
Ctps	T	A	4: 120,541,896	H553L	probably benign	Het
Dpysl2	A	G	14: 66,824,431	I242T	possibly damaging	Het
Fam229a	A	G	4: 129,491,411		probably benign	Het
Fshr	C	T	17: 88,985,534	R572H	probably damaging	Het
Gm5501	A	G	18: 9,917,267		noncoding transcript	Het
Gmpr	A	G	13: 45,529,747	I165V	probably benign	Het
Gnat3	G	A	5: 18,003,894		probably benign	Het
H1foo	A	G	6: 115,948,796	K185E	probably benign	Het
H2-Q4	T	G	17: 35,379,690	L16R	unknown	Het
Hs2st1	T	C	3: 144,434,628	K311E	possibly damaging	Het
Kcnj15	A	G	16: 95,296,509	E330G	possibly damaging	Het
Kif3a	A	G	11: 53,570,614	K29E	probably benign	Het
Krtap4-1	A	G	11: 99,628,157	V9A	unknown	Het
Lmntd2	C	T	7: 141,211,204	G432S	probably damaging	Het
Me3	T	C	7: 89,833,690		probably benign	Het
Myo1d	G	T	11: 80,484,261	R996S	probably benign	Het
Myo9a	T	A	9: 59,895,283	W2018R	probably damaging	Het
Nphp3	G	T	9: 104,011,730	V265F	probably damaging	Het
Olfr1331	T	C	4: 118,868,982	L66P	probably damaging	Het
Olfr492	A	G	7: 108,323,025	I217T	probably benign	Het
Olfr894	T	C	9: 38,218,835	M1T	probably null	Het
Pgp	A	G	17: 24,471,341	E247G	probably damaging	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plch1	G	A	3: 63,767,623	A202V	probably damaging	Het
Rbm11	G	A	16: 75,593,044		probably null	Het
Scg5	T	C	2: 113,791,885	K124R	probably damaging	Het
Serpina3j	A	T	12: 104,319,657	H357L	probably damaging	Het
St6gal2	A	G	17: 55,496,323	D353G	possibly damaging	Het
Tdpoz3	T	C	3: 93,826,909	I297T	possibly damaging	Het
Tdrd5	G	A	1: 156,300,778	T136I	probably benign	Het
Tfcp2l1	T	A	1: 118,669,476	I429K	possibly damaging	Het
Tnrc6c	C	T	11: 117,723,529	R838W	probably damaging	Het
Top1	T	C	2: 160,687,749		probably benign	Het
Trim61	A	G	8: 65,013,317	F431L	probably benign	Het
Trmo	C	T	4: 46,382,647	G150S	probably damaging	Het
Vmn1r183	T	C	7: 24,055,572	S267P	probably damaging	Het
Xirp2	T	A	2: 67,511,669	F1418Y	possibly damaging	Het
Zfp114	T	C	7: 24,181,042	V271A	possibly damaging	Het
Zfp710	A	G	7: 80,081,386	R104G	probably damaging	Het

Other mutations in Exoc3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Exoc3l	APN	8	105290498	missense	probably benign	0.25
IGL01731:Exoc3l	APN	8	105292955	missense	probably benign	0.16
IGL02364:Exoc3l	APN	8	105290577	missense	possibly damaging	0.71
IGL02413:Exoc3l	APN	8	105292438	missense	probably damaging	1.00
IGL02512:Exoc3l	APN	8	105290483	missense	probably damaging	1.00
IGL02810:Exoc3l	APN	8	105295348	missense	probably damaging	1.00
R0045:Exoc3l	UTSW	8	105293685	missense	probably damaging	1.00
R0045:Exoc3l	UTSW	8	105293685	missense	probably damaging	1.00
R0183:Exoc3l	UTSW	8	105295300	missense	probably damaging	1.00
R0302:Exoc3l	UTSW	8	105293543	missense	probably benign	0.01
R1660:Exoc3l	UTSW	8	105293060	critical splice donor site	probably null
R1699:Exoc3l	UTSW	8	105295013	missense	probably benign	0.34
R1826:Exoc3l	UTSW	8	105293618	missense	probably damaging	0.97
R2275:Exoc3l	UTSW	8	105290447	critical splice donor site	probably null
R3938:Exoc3l	UTSW	8	105293405	missense	probably damaging	1.00
R4261:Exoc3l	UTSW	8	105290967	missense	probably damaging	0.98
R4273:Exoc3l	UTSW	8	105289961	makesense	probably null
R5518:Exoc3l	UTSW	8	105293163	missense	probably benign	0.27
R6471:Exoc3l	UTSW	8	105290534	missense	probably damaging	1.00
R6511:Exoc3l	UTSW	8	105293255	missense	probably benign	0.00
R6631:Exoc3l	UTSW	8	105295361	missense	probably damaging	1.00
R6694:Exoc3l	UTSW	8	105290490	missense	probably benign	0.15
R6843:Exoc3l	UTSW	8	105290097	missense	probably benign	0.00
R7310:Exoc3l	UTSW	8	105293708	missense	probably damaging	1.00
R7387:Exoc3l	UTSW	8	105294973	missense	probably damaging	1.00
R7442:Exoc3l	UTSW	8	105292926	missense	probably damaging	1.00
R7764:Exoc3l	UTSW	8	105290701	missense	possibly damaging	0.62
R7845:Exoc3l	UTSW	8	105290150	missense	probably damaging	1.00
R7928:Exoc3l	UTSW	8	105290150	missense	probably damaging	1.00
Z1176:Exoc3l	UTSW	8	105290794	missense	not run

Predicted Primers

PCR Primer
(F):5'- CAGAAGTCCTGGCAGAAGTG -3'
(R):5'- GATGAATCCTAGAGGGCCATG -3'

Sequencing Primer
(F):5'- AGAAGTGCGACGTCTGCTCAC -3'
(R):5'- ATGCGAGCCTTGGCCTTG -3'

Posted On

2015-04-17