Incidental Mutation 'R3928:Nphp3'
ID308377
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Namenephronophthisis 3 (adolescent)
Synonyms3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
MMRRC Submission 040823-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3928 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location104002544-104043818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 104011730 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 265 (V265F)
Ref Sequence ENSEMBL: ENSMUSP00000141540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194774]
Predicted Effect probably benign
Transcript: ENSMUST00000035167
AA Change: V359F

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: V359F

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000116459
Gene: ENSMUSG00000032558
AA Change: V239F

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191919
Predicted Effect probably damaging
Transcript: ENSMUST00000193439
AA Change: V265F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558
AA Change: V265F

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193642
Predicted Effect probably benign
Transcript: ENSMUST00000194774
AA Change: V239F

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: V239F

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Meta Mutation Damage Score 0.0831 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,468,735 H181Q probably benign Het
Atrx T C X: 105,879,917 I157V possibly damaging Het
Birc6 A G 17: 74,611,175 D1856G possibly damaging Het
Birc6 A G 17: 74,638,409 T2811A probably damaging Het
Brsk2 T C 7: 141,998,418 F108S probably damaging Het
Clasp2 C A 9: 113,906,105 H1004N probably benign Het
Cntd1 G A 11: 101,287,519 V315I probably benign Het
Col13a1 A G 10: 61,867,525 probably benign Het
Ctps T A 4: 120,541,896 H553L probably benign Het
Dpysl2 A G 14: 66,824,431 I242T possibly damaging Het
Exoc3l C T 8: 105,290,917 probably benign Het
Fam229a A G 4: 129,491,411 probably benign Het
Fshr C T 17: 88,985,534 R572H probably damaging Het
Gm5501 A G 18: 9,917,267 noncoding transcript Het
Gmpr A G 13: 45,529,747 I165V probably benign Het
Gnat3 G A 5: 18,003,894 probably benign Het
H1foo A G 6: 115,948,796 K185E probably benign Het
H2-Q4 T G 17: 35,379,690 L16R unknown Het
Hs2st1 T C 3: 144,434,628 K311E possibly damaging Het
Kcnj15 A G 16: 95,296,509 E330G possibly damaging Het
Kif3a A G 11: 53,570,614 K29E probably benign Het
Krtap4-1 A G 11: 99,628,157 V9A unknown Het
Lmntd2 C T 7: 141,211,204 G432S probably damaging Het
Me3 T C 7: 89,833,690 probably benign Het
Myo1d G T 11: 80,484,261 R996S probably benign Het
Myo9a T A 9: 59,895,283 W2018R probably damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr492 A G 7: 108,323,025 I217T probably benign Het
Olfr894 T C 9: 38,218,835 M1T probably null Het
Pgp A G 17: 24,471,341 E247G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plch1 G A 3: 63,767,623 A202V probably damaging Het
Rbm11 G A 16: 75,593,044 probably null Het
Scg5 T C 2: 113,791,885 K124R probably damaging Het
Serpina3j A T 12: 104,319,657 H357L probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Tdpoz3 T C 3: 93,826,909 I297T possibly damaging Het
Tdrd5 G A 1: 156,300,778 T136I probably benign Het
Tfcp2l1 T A 1: 118,669,476 I429K possibly damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Top1 T C 2: 160,687,749 probably benign Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Trmo C T 4: 46,382,647 G150S probably damaging Het
Vmn1r183 T C 7: 24,055,572 S267P probably damaging Het
Xirp2 T A 2: 67,511,669 F1418Y possibly damaging Het
Zfp114 T C 7: 24,181,042 V271A possibly damaging Het
Zfp710 A G 7: 80,081,386 R104G probably damaging Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
R8039:Nphp3 UTSW 9 104031963 missense not run
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GATATAGAGACTGTTCTAAAGTATGCC -3'
(R):5'- AACGACACTGATAGATCTGATGG -3'

Sequencing Primer
(F):5'- TGCCTTTTAAGTGATAAGATCTTCTC -3'
(R):5'- ATTTGGGTGTGAGGTCAGTATG -3'
Posted On2015-04-17