Mutagenetix > Incidental Mutation

Incidental Mutation 'R3928:Myo1d'

308382

Institutional Source

Beutler Lab

Gene Symbol

Myo1d

Ensembl Gene

ENSMUSG00000035441

Gene Name

myosin ID

Synonyms

9930104H07Rik, D11Ertd9e

MMRRC Submission

040823-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3928 (G1)

Quality Score

224

Status

Validated

Chromosome

Chromosomal Location

80482126-80780025 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 80484261 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 996 (R996S)

Ref Sequence

ENSEMBL: ENSMUSP00000037819 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000053413]

AlphaFold

Q5SYD0

Predicted Effect

probably benign
Transcript: ENSMUST00000041065
AA Change: R996S

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: R996S

Domain	Start	End	E-Value	Type
MYSc	3	696	N/A	SMART
IQ	697	719	1.46e-3	SMART
Pfam:Myosin_TH1	803	1006	4.1e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000053413

SMART Domains

Protein: ENSMUSP00000099514
Gene: ENSMUSG00000048895

Domain	Start	End	E-Value	Type
Pfam:CDK5_activator	69	294	1.6e-100	PFAM

Meta Mutation Damage Score

0.1137

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

100% (48/48)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abr	A	T	11: 76,468,735	H181Q	probably benign	Het
Atrx	T	C	X: 105,879,917	I157V	possibly damaging	Het
Birc6	A	G	17: 74,611,175	D1856G	possibly damaging	Het
Birc6	A	G	17: 74,638,409	T2811A	probably damaging	Het
Brsk2	T	C	7: 141,998,418	F108S	probably damaging	Het
Clasp2	C	A	9: 113,906,105	H1004N	probably benign	Het
Cntd1	G	A	11: 101,287,519	V315I	probably benign	Het
Col13a1	A	G	10: 61,867,525		probably benign	Het
Ctps	T	A	4: 120,541,896	H553L	probably benign	Het
Dpysl2	A	G	14: 66,824,431	I242T	possibly damaging	Het
Exoc3l	C	T	8: 105,290,917		probably benign	Het
Fam229a	A	G	4: 129,491,411		probably benign	Het
Fshr	C	T	17: 88,985,534	R572H	probably damaging	Het
Gm5501	A	G	18: 9,917,267		noncoding transcript	Het
Gmpr	A	G	13: 45,529,747	I165V	probably benign	Het
Gnat3	G	A	5: 18,003,894		probably benign	Het
H1foo	A	G	6: 115,948,796	K185E	probably benign	Het
H2-Q4	T	G	17: 35,379,690	L16R	unknown	Het
Hs2st1	T	C	3: 144,434,628	K311E	possibly damaging	Het
Kcnj15	A	G	16: 95,296,509	E330G	possibly damaging	Het
Kif3a	A	G	11: 53,570,614	K29E	probably benign	Het
Krtap4-1	A	G	11: 99,628,157	V9A	unknown	Het
Lmntd2	C	T	7: 141,211,204	G432S	probably damaging	Het
Me3	T	C	7: 89,833,690		probably benign	Het
Myo9a	T	A	9: 59,895,283	W2018R	probably damaging	Het
Nphp3	G	T	9: 104,011,730	V265F	probably damaging	Het
Olfr1331	T	C	4: 118,868,982	L66P	probably damaging	Het
Olfr492	A	G	7: 108,323,025	I217T	probably benign	Het
Olfr894	T	C	9: 38,218,835	M1T	probably null	Het
Pgp	A	G	17: 24,471,341	E247G	probably damaging	Het
Pirb	A	T	7: 3,717,638	L287Q	probably benign	Het
Plch1	G	A	3: 63,767,623	A202V	probably damaging	Het
Rbm11	G	A	16: 75,593,044		probably null	Het
Scg5	T	C	2: 113,791,885	K124R	probably damaging	Het
Serpina3j	A	T	12: 104,319,657	H357L	probably damaging	Het
St6gal2	A	G	17: 55,496,323	D353G	possibly damaging	Het
Tdpoz3	T	C	3: 93,826,909	I297T	possibly damaging	Het
Tdrd5	G	A	1: 156,300,778	T136I	probably benign	Het
Tfcp2l1	T	A	1: 118,669,476	I429K	possibly damaging	Het
Tnrc6c	C	T	11: 117,723,529	R838W	probably damaging	Het
Top1	T	C	2: 160,687,749		probably benign	Het
Trim61	A	G	8: 65,013,317	F431L	probably benign	Het
Trmo	C	T	4: 46,382,647	G150S	probably damaging	Het
Vmn1r183	T	C	7: 24,055,572	S267P	probably damaging	Het
Xirp2	T	A	2: 67,511,669	F1418Y	possibly damaging	Het
Zfp114	T	C	7: 24,181,042	V271A	possibly damaging	Het
Zfp710	A	G	7: 80,081,386	R104G	probably damaging	Het

Other mutations in Myo1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00432:Myo1d	APN	11	80601740	missense	probably benign
IGL01087:Myo1d	APN	11	80682435	missense	probably damaging	1.00
IGL01326:Myo1d	APN	11	80684321	splice site	probably benign
IGL01431:Myo1d	APN	11	80674839	missense	probably damaging	1.00
IGL01595:Myo1d	APN	11	80676110	missense	probably benign	0.00
IGL01811:Myo1d	APN	11	80692997	missense	probably damaging	0.96
IGL02301:Myo1d	APN	11	80676853	missense	probably benign	0.23
IGL02388:Myo1d	APN	11	80637997	nonsense	probably null
IGL02485:Myo1d	APN	11	80666581	missense	probably damaging	1.00
IGL03017:Myo1d	APN	11	80601626	missense	probably benign	0.26
horton	UTSW	11	80674708	missense	probably damaging	1.00
multifaceted	UTSW	11	80693072	missense	probably damaging	1.00
whisper	UTSW	11	80484332	missense	probably damaging	0.99
whisper2	UTSW	11	80666578	missense	probably damaging	1.00
whisper3	UTSW	11	80557521	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0069:Myo1d	UTSW	11	80637953	missense	probably damaging	1.00
R0081:Myo1d	UTSW	11	80557523	missense	probably benign	0.00
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0096:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0244:Myo1d	UTSW	11	80674708	missense	probably damaging	1.00
R0711:Myo1d	UTSW	11	80484332	missense	probably damaging	0.99
R0746:Myo1d	UTSW	11	80586879	missense	possibly damaging	0.94
R1084:Myo1d	UTSW	11	80684395	missense	probably damaging	1.00
R1514:Myo1d	UTSW	11	80685908	missense	probably damaging	0.97
R1676:Myo1d	UTSW	11	80684421	missense	probably damaging	1.00
R1862:Myo1d	UTSW	11	80663048	missense	probably damaging	1.00
R2497:Myo1d	UTSW	11	80674821	missense	probably damaging	1.00
R2512:Myo1d	UTSW	11	80779717	missense	probably benign	0.00
R3425:Myo1d	UTSW	11	80601638	missense	probably benign
R3429:Myo1d	UTSW	11	80682410	missense	probably damaging	1.00
R3917:Myo1d	UTSW	11	80666578	missense	probably damaging	1.00
R4706:Myo1d	UTSW	11	80666641	missense	probably damaging	0.96
R4723:Myo1d	UTSW	11	80779841	utr 5 prime	probably benign
R4924:Myo1d	UTSW	11	80674678	missense	probably damaging	1.00
R5042:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R5320:Myo1d	UTSW	11	80684323	critical splice donor site	probably null
R5481:Myo1d	UTSW	11	80663095	missense	possibly damaging	0.79
R6214:Myo1d	UTSW	11	80779791	start codon destroyed	probably null	0.98
R6235:Myo1d	UTSW	11	80692944	missense	probably benign	0.23
R6282:Myo1d	UTSW	11	80557512	missense	probably damaging	0.99
R6468:Myo1d	UTSW	11	80557474	missense	probably benign	0.00
R6668:Myo1d	UTSW	11	80583875	intron	probably benign
R6954:Myo1d	UTSW	11	80674957	missense	probably benign	0.21
R7077:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7078:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7080:Myo1d	UTSW	11	80674634	missense	probably damaging	1.00
R7172:Myo1d	UTSW	11	80592795	missense	probably benign	0.16
R7276:Myo1d	UTSW	11	80693072	missense	probably damaging	1.00
R7467:Myo1d	UTSW	11	80586917	missense	probably damaging	1.00
R7650:Myo1d	UTSW	11	80601684	missense	probably benign
R7678:Myo1d	UTSW	11	80676893	missense	possibly damaging	0.80
R7859:Myo1d	UTSW	11	80684377	missense	probably damaging	1.00
R8324:Myo1d	UTSW	11	80557521	missense	probably damaging	1.00
R8329:Myo1d	UTSW	11	80638074	missense	probably benign	0.21
R8474:Myo1d	UTSW	11	80670919	missense	possibly damaging	0.93
R8799:Myo1d	UTSW	11	80684379	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80674932	missense	probably damaging	1.00
R8810:Myo1d	UTSW	11	80676932	missense	probably benign	0.30
R8823:Myo1d	UTSW	11	80601745	missense	possibly damaging	0.91
R9221:Myo1d	UTSW	11	80674918	missense	probably damaging	1.00
R9494:Myo1d	UTSW	11	80484267	missense	probably benign	0.02
R9625:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9626:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
R9628:Myo1d	UTSW	11	80557470	missense	possibly damaging	0.95
Z1088:Myo1d	UTSW	11	80674898	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGCTGATTTCTAGTGGCATTAGAG -3'
(R):5'- CTGAGGGTTGCCAAGGAAAC -3'

Sequencing Primer
(F):5'- ATTTCTAGTGGCATTAGAGGGCAGAC -3'
(R):5'- GTTGCCAAGGAAACCACAG -3'

Posted On

2015-04-17