Incidental Mutation 'R3928:Tnrc6c'
ID308384
Institutional Source Beutler Lab
Gene Symbol Tnrc6c
Ensembl Gene ENSMUSG00000025571
Gene Nametrinucleotide repeat containing 6C
Synonyms9930033H14Rik
MMRRC Submission 040823-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3928 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location117654289-117763439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117723529 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 838 (R838W)
Ref Sequence ENSEMBL: ENSMUSP00000115221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026658] [ENSMUST00000106344] [ENSMUST00000138299]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026658
AA Change: R998W

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026658
Gene: ENSMUSG00000025571
AA Change: R998W

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106344
AA Change: R998W

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101951
Gene: ENSMUSG00000025571
AA Change: R998W

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138299
AA Change: R838W

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115221
Gene: ENSMUSG00000025571
AA Change: R838W

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 280 297 N/A INTRINSIC
internal_repeat_1 312 413 9.45e-5 PROSPERO
low complexity region 434 454 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
internal_repeat_1 639 742 9.45e-5 PROSPERO
low complexity region 804 821 N/A INTRINSIC
low complexity region 903 919 N/A INTRINSIC
low complexity region 951 965 N/A INTRINSIC
UBA 985 1022 3.68e-4 SMART
Pfam:M_domain 1036 1293 1.7e-53 PFAM
low complexity region 1397 1406 N/A INTRINSIC
PDB:3KTP|B 1422 1443 7e-7 PDB
low complexity region 1507 1518 N/A INTRINSIC
low complexity region 1531 1552 N/A INTRINSIC
RRM 1557 1624 1.81e-2 SMART
low complexity region 1645 1655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141115
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality with cyanosis, respiratory distress and thickened mesenchyme in air sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A T 11: 76,468,735 H181Q probably benign Het
Atrx T C X: 105,879,917 I157V possibly damaging Het
Birc6 A G 17: 74,611,175 D1856G possibly damaging Het
Birc6 A G 17: 74,638,409 T2811A probably damaging Het
Brsk2 T C 7: 141,998,418 F108S probably damaging Het
Clasp2 C A 9: 113,906,105 H1004N probably benign Het
Cntd1 G A 11: 101,287,519 V315I probably benign Het
Col13a1 A G 10: 61,867,525 probably benign Het
Ctps T A 4: 120,541,896 H553L probably benign Het
Dpysl2 A G 14: 66,824,431 I242T possibly damaging Het
Exoc3l C T 8: 105,290,917 probably benign Het
Fam229a A G 4: 129,491,411 probably benign Het
Fshr C T 17: 88,985,534 R572H probably damaging Het
Gm5501 A G 18: 9,917,267 noncoding transcript Het
Gmpr A G 13: 45,529,747 I165V probably benign Het
Gnat3 G A 5: 18,003,894 probably benign Het
H1foo A G 6: 115,948,796 K185E probably benign Het
H2-Q4 T G 17: 35,379,690 L16R unknown Het
Hs2st1 T C 3: 144,434,628 K311E possibly damaging Het
Kcnj15 A G 16: 95,296,509 E330G possibly damaging Het
Kif3a A G 11: 53,570,614 K29E probably benign Het
Krtap4-1 A G 11: 99,628,157 V9A unknown Het
Lmntd2 C T 7: 141,211,204 G432S probably damaging Het
Me3 T C 7: 89,833,690 probably benign Het
Myo1d G T 11: 80,484,261 R996S probably benign Het
Myo9a T A 9: 59,895,283 W2018R probably damaging Het
Nphp3 G T 9: 104,011,730 V265F probably damaging Het
Olfr1331 T C 4: 118,868,982 L66P probably damaging Het
Olfr492 A G 7: 108,323,025 I217T probably benign Het
Olfr894 T C 9: 38,218,835 M1T probably null Het
Pgp A G 17: 24,471,341 E247G probably damaging Het
Pirb A T 7: 3,717,638 L287Q probably benign Het
Plch1 G A 3: 63,767,623 A202V probably damaging Het
Rbm11 G A 16: 75,593,044 probably null Het
Scg5 T C 2: 113,791,885 K124R probably damaging Het
Serpina3j A T 12: 104,319,657 H357L probably damaging Het
St6gal2 A G 17: 55,496,323 D353G possibly damaging Het
Tdpoz3 T C 3: 93,826,909 I297T possibly damaging Het
Tdrd5 G A 1: 156,300,778 T136I probably benign Het
Tfcp2l1 T A 1: 118,669,476 I429K possibly damaging Het
Top1 T C 2: 160,687,749 probably benign Het
Trim61 A G 8: 65,013,317 F431L probably benign Het
Trmo C T 4: 46,382,647 G150S probably damaging Het
Vmn1r183 T C 7: 24,055,572 S267P probably damaging Het
Xirp2 T A 2: 67,511,669 F1418Y possibly damaging Het
Zfp114 T C 7: 24,181,042 V271A possibly damaging Het
Zfp710 A G 7: 80,081,386 R104G probably damaging Het
Other mutations in Tnrc6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Tnrc6c APN 11 117714185 missense possibly damaging 0.91
IGL01013:Tnrc6c APN 11 117722029 missense probably benign 0.44
IGL01092:Tnrc6c APN 11 117721985 missense probably damaging 0.99
IGL01383:Tnrc6c APN 11 117714257 missense probably benign 0.37
IGL01395:Tnrc6c APN 11 117723113 missense probably benign 0.08
IGL01726:Tnrc6c APN 11 117749335 splice site probably benign
IGL01869:Tnrc6c APN 11 117755448 missense possibly damaging 0.65
IGL02108:Tnrc6c APN 11 117721199 missense probably benign 0.29
IGL02457:Tnrc6c APN 11 117722977 missense probably benign 0.28
IGL02612:Tnrc6c APN 11 117743000 missense possibly damaging 0.95
IGL02748:Tnrc6c APN 11 117732170 missense probably benign 0.00
IGL03160:Tnrc6c APN 11 117749825 splice site probably benign
rodion UTSW 11 117738350 critical splice donor site probably null
F5770:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
K3955:Tnrc6c UTSW 11 117760738 missense probably damaging 0.99
R0015:Tnrc6c UTSW 11 117721458 missense probably damaging 0.98
R0143:Tnrc6c UTSW 11 117752985 missense probably damaging 1.00
R0277:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0323:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0464:Tnrc6c UTSW 11 117760549 missense probably damaging 1.00
R0699:Tnrc6c UTSW 11 117722621 missense probably benign 0.02
R1015:Tnrc6c UTSW 11 117721922 missense possibly damaging 0.89
R1201:Tnrc6c UTSW 11 117721674 missense probably damaging 0.96
R1297:Tnrc6c UTSW 11 117733703 missense possibly damaging 0.52
R1560:Tnrc6c UTSW 11 117759637 missense probably damaging 1.00
R1596:Tnrc6c UTSW 11 117758041 missense probably damaging 1.00
R1758:Tnrc6c UTSW 11 117760730 missense probably benign 0.09
R1892:Tnrc6c UTSW 11 117714362 missense probably benign
R1901:Tnrc6c UTSW 11 117723005 missense probably damaging 0.98
R1935:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1936:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1937:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1940:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R3622:Tnrc6c UTSW 11 117749625 missense probably damaging 1.00
R3711:Tnrc6c UTSW 11 117723124 missense probably benign 0.00
R3725:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3775:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3776:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3836:Tnrc6c UTSW 11 117723229 missense probably benign 0.20
R3844:Tnrc6c UTSW 11 117755483 missense probably damaging 1.00
R3852:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3929:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3937:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3943:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R4501:Tnrc6c UTSW 11 117722498 missense probably damaging 1.00
R4510:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4511:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4654:Tnrc6c UTSW 11 117720971 missense probably benign
R4765:Tnrc6c UTSW 11 117742927 missense probably benign 0.09
R4824:Tnrc6c UTSW 11 117722905 missense probably damaging 0.98
R5004:Tnrc6c UTSW 11 117721046 missense probably benign 0.44
R5094:Tnrc6c UTSW 11 117721046 missense probably benign 0.00
R5130:Tnrc6c UTSW 11 117738350 critical splice donor site probably null
R5234:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5235:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5345:Tnrc6c UTSW 11 117723287 missense possibly damaging 0.80
R5359:Tnrc6c UTSW 11 117758905 splice site silent
R5428:Tnrc6c UTSW 11 117700762 start codon destroyed probably null
R5548:Tnrc6c UTSW 11 117760843 missense possibly damaging 0.96
R5587:Tnrc6c UTSW 11 117749271 nonsense probably null
R5875:Tnrc6c UTSW 11 117759708 missense probably damaging 0.99
R5947:Tnrc6c UTSW 11 117722519 missense probably damaging 1.00
R6135:Tnrc6c UTSW 11 117736005 missense probably damaging 0.97
R6354:Tnrc6c UTSW 11 117749614 missense possibly damaging 0.90
R6389:Tnrc6c UTSW 11 117722741 missense probably damaging 0.99
R7027:Tnrc6c UTSW 11 117733618 missense probably damaging 1.00
R7048:Tnrc6c UTSW 11 117721974 missense probably benign 0.41
R7098:Tnrc6c UTSW 11 117714126 missense probably benign 0.03
R7315:Tnrc6c UTSW 11 117723528 missense probably benign 0.11
R7378:Tnrc6c UTSW 11 117741780 missense probably benign 0.03
R7386:Tnrc6c UTSW 11 117721954 missense probably benign
R7515:Tnrc6c UTSW 11 117741681 missense probably benign 0.03
R7665:Tnrc6c UTSW 11 117720951 missense possibly damaging 0.46
V7580:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7581:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7582:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7583:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGGTACCTCAGCTTGGG -3'
(R):5'- TCACTGTTGGAAGCATGATGAAAAG -3'

Sequencing Primer
(F):5'- ATCCAGTCATCCAGAGCA -3'
(R):5'- TGGCAGTACTGAGCACACC -3'
Posted On2015-04-17