Mutagenetix > Incidental Mutations

Incidental Mutation 'R0379:Etl4'

30840

Institutional Source

Beutler Lab

Gene Symbol

Etl4

Ensembl Gene

ENSMUSG00000036617

Gene Name

enhancer trap locus 4

Synonyms

6620402G01Rik, 9430077C05Rik, Skt, Sickle tail, E330027G05Rik, Etl-4

MMRRC Submission

038585-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.828) question?

Stock #

R0379 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19909780-20810713 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20807354 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 1416 (I1416K)

Ref Sequence

ENSEMBL: ENSMUSP00000110255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045555] [ENSMUST00000066509] [ENSMUST00000114604] [ENSMUST00000114606] [ENSMUST00000114607] [ENSMUST00000114608] [ENSMUST00000114614] [ENSMUST00000114627]

Predicted Effect

probably benign
Transcript: ENSMUST00000045555

SMART Domains

Protein: ENSMUSP00000041431
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	620	652	N/A	INTRINSIC
low complexity region	1067	1096	N/A	INTRINSIC
low complexity region	1212	1231	N/A	INTRINSIC
low complexity region	1296	1314	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066509
AA Change: I1733K

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000066170
Gene: ENSMUSG00000036617
AA Change: I1733K

Domain	Start	End	E-Value	Type
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	655	687	N/A	INTRINSIC
low complexity region	1102	1131	N/A	INTRINSIC
low complexity region	1372	1381	N/A	INTRINSIC
low complexity region	1470	1495	N/A	INTRINSIC
low complexity region	1571	1582	N/A	INTRINSIC
coiled coil region	1658	1686	N/A	INTRINSIC
low complexity region	1724	1737	N/A	INTRINSIC
low complexity region	1806	1825	N/A	INTRINSIC
low complexity region	1890	1908	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114604

SMART Domains

Protein: ENSMUSP00000110251
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	655	687	N/A	INTRINSIC
low complexity region	1102	1131	N/A	INTRINSIC
low complexity region	1207	1226	N/A	INTRINSIC
low complexity region	1291	1309	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114606

SMART Domains

Protein: ENSMUSP00000110253
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
low complexity region	31	46	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
coiled coil region	338	370	N/A	INTRINSIC
low complexity region	785	814	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114607

SMART Domains

Protein: ENSMUSP00000110254
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
low complexity region	31	46	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
coiled coil region	338	370	N/A	INTRINSIC
low complexity region	785	814	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114608
AA Change: I1416K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000110255
Gene: ENSMUSG00000036617
AA Change: I1416K

Domain	Start	End	E-Value	Type
low complexity region	31	46	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
coiled coil region	338	370	N/A	INTRINSIC
low complexity region	785	814	N/A	INTRINSIC
low complexity region	1055	1064	N/A	INTRINSIC
low complexity region	1153	1178	N/A	INTRINSIC
low complexity region	1254	1265	N/A	INTRINSIC
coiled coil region	1341	1369	N/A	INTRINSIC
low complexity region	1407	1420	N/A	INTRINSIC
low complexity region	1489	1508	N/A	INTRINSIC
low complexity region	1573	1591	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114614

SMART Domains

Protein: ENSMUSP00000110261
Gene: ENSMUSG00000036617

Domain	Start	End	E-Value	Type
Pfam:AIP3	188	291	1.7e-11	PFAM
low complexity region	313	328	N/A	INTRINSIC
low complexity region	350	368	N/A	INTRINSIC
coiled coil region	620	652	N/A	INTRINSIC
low complexity region	1056	1085	N/A	INTRINSIC
low complexity region	1201	1220	N/A	INTRINSIC
low complexity region	1285	1303	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114627
AA Change: I1784K

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000110274
Gene: ENSMUSG00000036617
AA Change: I1784K

Domain	Start	End	E-Value	Type
low complexity region	21	38	N/A	INTRINSIC
low complexity region	60	72	N/A	INTRINSIC
Pfam:AIP3	239	341	2.4e-14	PFAM
low complexity region	364	379	N/A	INTRINSIC
low complexity region	401	419	N/A	INTRINSIC
Pfam:AIP3	600	841	1.1e-12	PFAM
low complexity region	1153	1182	N/A	INTRINSIC
low complexity region	1423	1432	N/A	INTRINSIC
low complexity region	1521	1546	N/A	INTRINSIC
low complexity region	1622	1633	N/A	INTRINSIC
coiled coil region	1709	1737	N/A	INTRINSIC
low complexity region	1775	1788	N/A	INTRINSIC
low complexity region	1857	1876	N/A	INTRINSIC
low complexity region	1941	1959	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125772

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139531

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156587

Meta Mutation Damage Score

0.1169

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.7%
20x: 90.9%

Validation Efficiency

98% (79/81)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene-trapped allele display malformations of the notochord and caudal vertebrae and may exhibit caudal tail kinks. Mice homozygous for another gene-trapped allele have malformed caudal vertebrae and intervertebral disk abnormalities; about half display kinked tails. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	T	2: 130,785,546		probably benign	Het
4930512M02Rik	A	G	11: 11,589,365		probably benign	Het
Apba1	A	C	19: 23,934,830	N558T	probably damaging	Het
Arfgef2	T	A	2: 166,860,400		probably null	Het
Arsb	T	C	13: 93,940,627	S501P	probably benign	Het
Atp10b	A	G	11: 43,254,314	T1295A	probably benign	Het
Atp8b5	G	T	4: 43,361,898	R648L	probably damaging	Het
Bcl2a1b	T	C	9: 89,199,736	I126T	possibly damaging	Het
Brd9	T	C	13: 73,942,683		probably benign	Het
Cd93	T	C	2: 148,441,510		probably benign	Het
Chd5	A	G	4: 152,383,321	K1692R	probably benign	Het
Clcn4	T	C	7: 7,296,792	T13A	probably damaging	Het
Clec14a	A	G	12: 58,268,794	F14S	possibly damaging	Het
Clec4g	A	G	8: 3,718,440	V97A	probably benign	Het
Col24a1	G	A	3: 145,524,142	R1483K	possibly damaging	Het
Crem	A	T	18: 3,299,226	V82D	probably damaging	Het
Ctnna2	T	A	6: 77,641,440	T180S	probably benign	Het
Cybrd1	T	C	2: 71,129,755	I99T	probably benign	Het
Cyp4a32	G	A	4: 115,621,474	V468M	probably damaging	Het
Dlk1	A	G	12: 109,455,059		probably benign	Het
Dnah7b	A	T	1: 46,140,176	Y1003F	probably benign	Het
Egfem1	A	C	3: 29,668,250	E376A	possibly damaging	Het
Fbxl4	A	G	4: 22,386,106	T238A	probably benign	Het
Fer1l6	A	G	15: 58,548,338	I33M	probably benign	Het
Fndc3a	A	G	14: 72,556,609	S830P	probably damaging	Het
Fras1	C	T	5: 96,755,509	R3082*	probably null	Het
Galnt13	T	C	2: 55,060,492	V395A	possibly damaging	Het
Gm10334	T	G	6: 41,445,256		probably benign	Het
Gpd2	C	T	2: 57,345,263	T335I	probably damaging	Het
Gucy2d	C	A	7: 98,459,002		probably null	Het
Hydin	A	G	8: 110,509,127		probably benign	Het
Ints5	G	T	19: 8,897,133	V819L	possibly damaging	Het
Klhdc10	C	G	6: 30,450,670	Q292E	possibly damaging	Het
Lmbrd2	G	A	15: 9,149,479	A67T	probably benign	Het
Lrp1	T	G	10: 127,594,969	T404P	probably damaging	Het
March7	T	C	2: 60,234,126	S249P	probably benign	Het
Mcm10	T	A	2: 5,008,623	K66M	probably benign	Het
Mtmr7	C	A	8: 40,551,601	D645Y	probably damaging	Het
Muc6	T	A	7: 141,636,955	I2602F	possibly damaging	Het
Myh13	G	A	11: 67,369,295		probably benign	Het
Myo18a	G	A	11: 77,850,806	V1776I	possibly damaging	Het
Ncapg2	T	C	12: 116,443,075	L957S	probably damaging	Het
Ncoa3	T	C	2: 166,054,502	S442P	probably damaging	Het
Olfr1093	G	A	2: 86,785,735	E2K	probably benign	Het
Olfr850	T	A	9: 19,477,480	T257S	possibly damaging	Het
Olfr986	G	A	9: 40,187,433	G106D	probably damaging	Het
Pdcd6	G	T	13: 74,309,712	N113K	possibly damaging	Het
Pfkfb4	C	T	9: 109,027,742		probably benign	Het
Pfkm	A	G	15: 98,126,314	H401R	probably benign	Het
Phldb2	C	A	16: 45,781,451	D754Y	probably damaging	Het
Plekhb2	T	A	1: 34,863,114	M49K	probably damaging	Het
Polrmt	A	G	10: 79,737,611	S1057P	possibly damaging	Het
Prps1l1	A	G	12: 34,985,078	N64S	probably benign	Het
Psg16	T	C	7: 17,130,658	S393P	probably benign	Het
Rundc1	C	T	11: 101,425,147	T15I	probably benign	Het
Scaf11	A	G	15: 96,431,816	L143S	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Serpinf1	T	G	11: 75,413,945	I197L	probably benign	Het
Siglec1	C	T	2: 131,074,525		probably benign	Het
Slc28a1	G	A	7: 81,138,177	V271I	probably benign	Het
Sntg1	T	C	1: 8,782,824	D34G	probably damaging	Het
Sptbn4	A	T	7: 27,359,736		probably benign	Het
Suclg1	T	C	6: 73,256,228	I51T	possibly damaging	Het
Syne1	C	T	10: 5,541,989	R9Q	probably damaging	Het
Trim47	T	A	11: 116,106,518	H470L	probably damaging	Het
Ttc41	T	A	10: 86,712,977	Y12N	possibly damaging	Het
Tubgcp2	T	C	7: 140,032,192	E69G	probably damaging	Het
Tubgcp3	G	A	8: 12,641,116	T474M	probably damaging	Het
Ubr5	A	T	15: 38,018,957	N777K	probably benign	Het
Ush2a	T	C	1: 188,451,819	L1440P	probably damaging	Het
Usp28	A	C	9: 49,024,067	D458A	possibly damaging	Het
Vcan	A	T	13: 89,703,546	D1098E	probably damaging	Het
Vmn1r73	C	T	7: 11,756,846	T197I	probably benign	Het
Vmn2r15	T	C	5: 109,286,478	S787G	probably damaging	Het
Vmn2r90	T	A	17: 17,728,139	I549N	probably damaging	Het
Vps33b	T	A	7: 80,283,414		probably null	Het
Zfp516	A	T	18: 82,987,670	K900*	probably null	Het
Zfp974	T	A	7: 27,910,932	N456I	probably damaging	Het

Other mutations in Etl4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00907:Etl4	APN	2	20766478	missense	possibly damaging	0.81
IGL00944:Etl4	APN	2	20530054	missense	possibly damaging	0.52
IGL01078:Etl4	APN	2	20806531	nonsense	probably null
IGL01099:Etl4	APN	2	20807111	missense	probably benign	0.06
IGL01337:Etl4	APN	2	20785387	missense	probably benign	0.01
IGL01348:Etl4	APN	2	20806973	missense	probably damaging	1.00
IGL01349:Etl4	APN	2	20713396	missense	probably damaging	1.00
IGL01407:Etl4	APN	2	20743856	missense	probably damaging	0.99
IGL01552:Etl4	APN	2	20778189	missense	probably damaging	0.99
IGL01662:Etl4	APN	2	20806649	missense	probably benign	0.04
IGL01687:Etl4	APN	2	20530087	missense	probably damaging	1.00
IGL01793:Etl4	APN	2	20743898	missense	possibly damaging	0.87
IGL01844:Etl4	APN	2	20806682	missense	probably benign	0.06
IGL02025:Etl4	APN	2	20806526	missense	probably damaging	1.00
IGL02088:Etl4	APN	2	20806548	missense	probably damaging	1.00
IGL02134:Etl4	APN	2	20806429	missense	possibly damaging	0.79
IGL02369:Etl4	APN	2	20530189	missense	probably damaging	1.00
IGL02480:Etl4	APN	2	20788524	missense	probably damaging	0.99
IGL02560:Etl4	APN	2	20743718	missense	probably damaging	1.00
IGL02851:Etl4	APN	2	20808029	missense	possibly damaging	0.46
IGL02893:Etl4	APN	2	20760210	splice site	probably benign
IGL02951:Etl4	APN	2	20801537	splice site	probably benign
IGL03119:Etl4	APN	2	20713387	missense	probably damaging	1.00
IGL03267:Etl4	APN	2	20785182	nonsense	probably null
IGL03379:Etl4	APN	2	20662016	missense	possibly damaging	0.87
R0038:Etl4	UTSW	2	20743574	missense	probably damaging	1.00
R0038:Etl4	UTSW	2	20743574	missense	probably damaging	1.00
R0095:Etl4	UTSW	2	20743868	missense	probably damaging	1.00
R0100:Etl4	UTSW	2	20339905	missense	probably benign
R0311:Etl4	UTSW	2	20807129	missense	probably damaging	1.00
R0346:Etl4	UTSW	2	20759652	critical splice donor site	probably null
R0348:Etl4	UTSW	2	20778129	missense	probably damaging	1.00
R0571:Etl4	UTSW	2	20743769	missense	probably damaging	0.99
R0697:Etl4	UTSW	2	20743861	missense	probably damaging	1.00
R0707:Etl4	UTSW	2	20805571	splice site	probably benign
R0980:Etl4	UTSW	2	20801567	missense	probably damaging	1.00
R1120:Etl4	UTSW	2	20806703	missense	probably benign	0.00
R1254:Etl4	UTSW	2	20807923	missense	probably damaging	1.00
R1346:Etl4	UTSW	2	20806144	missense	possibly damaging	0.94
R1460:Etl4	UTSW	2	20788477	missense	probably damaging	1.00
R1503:Etl4	UTSW	2	20743874	missense	possibly damaging	0.94
R1547:Etl4	UTSW	2	20785228	missense	probably damaging	1.00
R1627:Etl4	UTSW	2	20801579	missense	possibly damaging	0.91
R1635:Etl4	UTSW	2	20806408	missense	probably damaging	1.00
R1716:Etl4	UTSW	2	20743681	missense	probably damaging	1.00
R1795:Etl4	UTSW	2	20808026	critical splice donor site	probably null
R1885:Etl4	UTSW	2	20743984	missense	probably damaging	1.00
R2039:Etl4	UTSW	2	20785228	missense	probably damaging	1.00
R2083:Etl4	UTSW	2	20743549	missense	probably damaging	1.00
R2109:Etl4	UTSW	2	20785342	missense	probably benign	0.27
R2153:Etl4	UTSW	2	20798734	missense	probably benign	0.00
R2403:Etl4	UTSW	2	20807306	nonsense	probably null
R2883:Etl4	UTSW	2	20806174	missense	possibly damaging	0.83
R2985:Etl4	UTSW	2	20781849	missense	probably damaging	1.00
R3402:Etl4	UTSW	2	20781882	missense	probably damaging	1.00
R3696:Etl4	UTSW	2	20801662	critical splice donor site	probably null
R3755:Etl4	UTSW	2	20743537	missense	probably benign	0.10
R3813:Etl4	UTSW	2	20788435	missense	probably damaging	1.00
R3829:Etl4	UTSW	2	20785421	missense	probably benign	0.07
R3887:Etl4	UTSW	2	20529961	nonsense	probably null
R3888:Etl4	UTSW	2	20529961	nonsense	probably null
R3889:Etl4	UTSW	2	20529961	nonsense	probably null
R3958:Etl4	UTSW	2	20340043	missense	probably benign
R3959:Etl4	UTSW	2	20340043	missense	probably benign
R3960:Etl4	UTSW	2	20340043	missense	probably benign
R4058:Etl4	UTSW	2	20806019	missense	possibly damaging	0.59
R4074:Etl4	UTSW	2	20809219	utr 3 prime	probably benign
R4077:Etl4	UTSW	2	20807961	missense	probably damaging	1.00
R4078:Etl4	UTSW	2	20807961	missense	probably damaging	1.00
R4127:Etl4	UTSW	2	20744075	missense	possibly damaging	0.93
R4200:Etl4	UTSW	2	20781883	missense	probably damaging	1.00
R4492:Etl4	UTSW	2	20806865	missense	possibly damaging	0.67
R4514:Etl4	UTSW	2	20661898	missense	probably damaging	1.00
R4820:Etl4	UTSW	2	20806685	missense	possibly damaging	0.85
R4825:Etl4	UTSW	2	20806927	missense	probably damaging	1.00
R4888:Etl4	UTSW	2	20340111	critical splice donor site	probably null
R4938:Etl4	UTSW	2	20798649	missense	probably benign	0.00
R4943:Etl4	UTSW	2	20807281	missense	probably benign	0.05
R5121:Etl4	UTSW	2	20340111	critical splice donor site	probably null
R5191:Etl4	UTSW	2	20339999	missense	probably damaging	0.99
R5198:Etl4	UTSW	2	20713387	missense	probably damaging	1.00
R5199:Etl4	UTSW	2	20744042	missense	probably damaging	1.00
R5470:Etl4	UTSW	2	20529980	missense	probably damaging	0.99
R5513:Etl4	UTSW	2	20743827	missense	probably damaging	1.00
R5620:Etl4	UTSW	2	20530226	missense	probably damaging	1.00
R5635:Etl4	UTSW	2	20807035	missense	probably damaging	1.00
R5641:Etl4	UTSW	2	20806462	frame shift	probably null
R5690:Etl4	UTSW	2	20805836	missense	probably benign	0.01
R5784:Etl4	UTSW	2	20806205	missense	possibly damaging	0.79
R5794:Etl4	UTSW	2	20806512	missense	probably damaging	1.00
R5908:Etl4	UTSW	2	20743907	missense	probably damaging	0.96
R5982:Etl4	UTSW	2	20781015	missense	probably damaging	1.00
R6151:Etl4	UTSW	2	20713360	missense	probably damaging	1.00
R6192:Etl4	UTSW	2	20801551	missense	probably damaging	0.98
R6238:Etl4	UTSW	2	20801568	missense	probably damaging	1.00
R6248:Etl4	UTSW	2	20809089	missense	possibly damaging	0.90
R6292:Etl4	UTSW	2	20743573	missense	probably damaging	1.00
R6610:Etl4	UTSW	2	20713369	missense	probably damaging	1.00
R6739:Etl4	UTSW	2	20713435	missense	probably damaging	1.00
R6846:Etl4	UTSW	2	20744108	missense	possibly damaging	0.94
R6863:Etl4	UTSW	2	20806309	missense	probably benign	0.01
R6873:Etl4	UTSW	2	20797992	synonymous	probably null
R7003:Etl4	UTSW	2	20805884	missense	probably benign	0.03
R7155:Etl4	UTSW	2	20806931	missense	probably damaging	0.96
R7207:Etl4	UTSW	2	20709576	missense	probably damaging	0.99
R7230:Etl4	UTSW	2	20797988	missense	probably damaging	1.00
R7305:Etl4	UTSW	2	20709557	missense	probably damaging	1.00
R7389:Etl4	UTSW	2	20785093	nonsense	probably null
R7396:Etl4	UTSW	2	20798638	missense	possibly damaging	0.62
R7441:Etl4	UTSW	2	20744189	missense	possibly damaging	0.87
R7626:Etl4	UTSW	2	20713378	missense	probably damaging	1.00
X0018:Etl4	UTSW	2	20809190	missense	probably damaging	0.98
X0022:Etl4	UTSW	2	20709564	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAATCAGTGAAATGAGCCCCAGG -3'
(R):5'- AGTGCCCTACATGCAGGATAGACC -3'

Sequencing Primer
(F):5'- GGCCCTAGTTGATACCTCATGTTC -3'
(R):5'- GACGAATAGacaaaaacaaacaaaac -3'

Posted On

2013-04-24