Mutagenetix > Incidental Mutations

Incidental Mutation 'R3930:Ubr1'

308407

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

040917-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.747) question?

Stock #

R3930 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120860269-120970715 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 120916470 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 830 (D830G)

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

Predicted Effect

probably benign
Transcript: ENSMUST00000028728
AA Change: D830G

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: D830G

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129790

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154023

Meta Mutation Damage Score

0.2573

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.1%
20x: 94.2%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	G	T	10: 116,112,635	Q329K	possibly damaging	Het
Bpifb1	A	G	2: 154,215,322	N400S	possibly damaging	Het
Cep250	G	A	2: 155,992,632	R2159K	probably damaging	Het
Crhr1	T	A	11: 104,153,551	S22T	probably benign	Het
Cyp4a10	G	T	4: 115,524,783	V221L	probably benign	Het
D1Pas1	G	T	1: 186,968,280	W135C	probably damaging	Het
Dcbld2	T	C	16: 58,465,338	L620P	probably damaging	Het
Dnah17	C	T	11: 118,080,849		probably benign	Het
Dnm3	T	C	1: 162,084,130	D66G	probably damaging	Het
Fzd10	G	A	5: 128,602,412	V399M	probably damaging	Het
Gm10801	T	A	2: 98,664,016	I146N	possibly damaging	Het
Gm20767	G	A	13: 120,154,832	C69Y	probably damaging	Het
Gm436	C	T	4: 144,670,128	E345K	probably damaging	Het
Gm525	T	A	11: 89,075,004		probably null	Het
Gpr37l1	T	C	1: 135,161,362	I322V	probably benign	Het
Grid2ip	T	G	5: 143,386,039	S679R	probably damaging	Het
Gyg	A	T	3: 20,155,025	S15T	probably benign	Het
Hace1	G	A	10: 45,711,508	C901Y	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hp1bp3	C	T	4: 138,221,707	A27V	probably benign	Het
Hsf5	A	G	11: 87,631,682	Y367C	probably damaging	Het
Igf2r	T	C	17: 12,705,829	I1034V	probably benign	Het
Itpr1	A	G	6: 108,394,841	T1159A	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrrc14	T	C	15: 76,713,565	V165A	probably benign	Het
Lrrc45	C	T	11: 120,718,677	A422V	probably benign	Het
Lrrk2	T	A	15: 91,767,461		probably null	Het
Map3k4	T	C	17: 12,235,993	H1370R	possibly damaging	Het
Mpo	A	G	11: 87,801,040	Y433C	probably damaging	Het
Nfkbil1	G	T	17: 35,220,956	Q194K	probably benign	Het
Nin	C	T	12: 70,078,242	G102E	probably damaging	Het
Nmt1	T	C	11: 103,052,233	V138A	probably benign	Het
Olfr1215	A	G	2: 89,002,033	F85S	probably benign	Het
Olfr430	T	A	1: 174,069,581	F94L	probably damaging	Het
Olfr432	A	T	1: 174,050,510	I46F	probably damaging	Het
Olfr629	A	C	7: 103,740,587	Y218D	probably damaging	Het
Optc	T	A	1: 133,901,182	R176*	probably null	Het
Oxct1	T	A	15: 4,037,119	N72K	possibly damaging	Het
Plxna2	G	A	1: 194,794,910	A1243T	probably benign	Het
Rin1	G	T	19: 5,052,974	L430F	probably benign	Het
Ros1	A	T	10: 52,194,848	S37T	possibly damaging	Het
Rrp36	G	T	17: 46,672,806	Q27K	probably damaging	Het
Sez6	T	C	11: 77,976,882	I875T	probably damaging	Het
Sfrp5	T	G	19: 42,201,818	Y65S	probably damaging	Het
Slc25a54	T	A	3: 109,116,504	L472I	probably benign	Het
Slc35d3	T	C	10: 19,848,859	E417G	probably damaging	Het
Sumf2	A	G	5: 129,849,979	D52G	probably benign	Het
Sympk	A	G	7: 19,047,522	N801S	possibly damaging	Het
Tmem38b	T	C	4: 53,854,398	F210S	probably damaging	Het
Tnks	T	A	8: 34,940,812	H254L	probably damaging	Het
Trappc10	A	T	10: 78,210,403	V451E	probably benign	Het
Trim43a	A	T	9: 88,583,078	I153F	probably benign	Het
Tulp1	T	C	17: 28,353,709	N213S	probably damaging	Het
Uqcc3	C	T	19: 8,880,705		probably null	Het
Vmn2r26	T	A	6: 124,025,979	M116K	probably benign	Het
Zscan12	A	G	13: 21,368,630	Q208R	probably benign	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120875407	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120941093	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120930872	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120914905	missense	probably benign
IGL01346:Ubr1	APN	2	120873122	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120941131	splice site	probably benign
IGL01539:Ubr1	APN	2	120926013	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120934342	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120875398	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120921386	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120900508	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120946349	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120970603	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120864373	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120870979	splice site	probably benign
IGL02627:Ubr1	APN	2	120940991	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120914883	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120941091	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120881183	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120961156	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120864417	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120895160	missense	probably benign
I1329:Ubr1	UTSW	2	120934294	splice site	probably benign
R0022:Ubr1	UTSW	2	120961173	splice site	probably benign
R0345:Ubr1	UTSW	2	120904103	splice site	probably null
R0373:Ubr1	UTSW	2	120946657	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120906946	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120881093	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120947883	nonsense	probably null
R0723:Ubr1	UTSW	2	120881101	nonsense	probably null
R1178:Ubr1	UTSW	2	120926029	nonsense	probably null
R1401:Ubr1	UTSW	2	120955644	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120961098	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120935319	splice site	probably benign
R1920:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120946273	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120942553	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120864330	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120926047	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120909482	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120963448	missense	probably benign	0.02
R3979:Ubr1	UTSW	2	120862687	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120946622	splice site	probably null
R4173:Ubr1	UTSW	2	120946622	splice site	probably null
R4174:Ubr1	UTSW	2	120946622	splice site	probably null
R4241:Ubr1	UTSW	2	120934386	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120970603	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120895066	splice site	probably null
R4449:Ubr1	UTSW	2	120946381	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120942482	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120926013	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120963442	nonsense	probably null
R4928:Ubr1	UTSW	2	120914938	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120963566	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120911997	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120963422	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120882264	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120893170	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120904044	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120963500	missense	probably benign
R5452:Ubr1	UTSW	2	120868302	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120915407	missense	probably benign
R5610:Ubr1	UTSW	2	120892112	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120963517	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120961092	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120904005	missense	probably benign
R5979:Ubr1	UTSW	2	120946382	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120893209	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120906895	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120881039	missense	probably benign	0.03
R6600:Ubr1	UTSW	2	120915399	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120924130	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120955640	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120896675	splice site	probably null
R6994:Ubr1	UTSW	2	120963593	missense	probably benign
R7121:Ubr1	UTSW	2	120875498	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120904077	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120862765	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120862680	missense	probably benign
R7457:Ubr1	UTSW	2	120917828	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120889774	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120875444	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120873191	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120934374	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120934417	nonsense	probably null
R8221:Ubr1	UTSW	2	120961104	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120963456	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120911115	missense	probably benign
R8293:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120870995	missense	probably benign
R8489:Ubr1	UTSW	2	120881067	missense	probably benign	0.42
R8708:Ubr1	UTSW	2	120866483	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- GTCCTGAATCCTCTTCTGTAGCAAC -3'
(R):5'- AGCAAACTCCCAGATTTGTTTG -3'

Sequencing Primer
(F):5'- ATCCTCTTCTGTAGCAACTATTACAG -3'
(R):5'- CAAACTCCCAGATTTGTTTGAATTTC -3'

Posted On

2015-04-17