Incidental Mutation 'R3930:Slc25a54'
ID308412
Institutional Source Beutler Lab
Gene Symbol Slc25a54
Ensembl Gene ENSMUSG00000027880
Gene Namesolute carrier family 25, member 54
Synonyms4930443G12Rik, SCaMC-1like
MMRRC Submission 040917-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R3930 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location109080469-109116687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109116504 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 472 (L472I)
Ref Sequence ENSEMBL: ENSMUSP00000029478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029478] [ENSMUST00000159926]
Predicted Effect probably benign
Transcript: ENSMUST00000029478
AA Change: L472I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029478
Gene: ENSMUSG00000027880
AA Change: L472I

DomainStartEndE-ValueType
EFh 23 51 4.28e0 SMART
EFh 59 87 3.82e0 SMART
EFh 90 118 4.12e-3 SMART
EFh 126 154 3.44e1 SMART
Pfam:Mito_carr 191 283 3.7e-25 PFAM
Pfam:Mito_carr 284 376 7.2e-24 PFAM
Pfam:Mito_carr 383 472 2.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159926
SMART Domains Protein: ENSMUSP00000124484
Gene: ENSMUSG00000027880

DomainStartEndE-ValueType
Blast:EFh 1 21 6e-9 BLAST
Pfam:Mito_carr 57 150 3.2e-26 PFAM
Pfam:Mito_carr 151 243 3.6e-25 PFAM
Pfam:Mito_carr 249 339 1.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198512
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik G T 10: 116,112,635 Q329K possibly damaging Het
Bpifb1 A G 2: 154,215,322 N400S possibly damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Crhr1 T A 11: 104,153,551 S22T probably benign Het
Cyp4a10 G T 4: 115,524,783 V221L probably benign Het
D1Pas1 G T 1: 186,968,280 W135C probably damaging Het
Dcbld2 T C 16: 58,465,338 L620P probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnm3 T C 1: 162,084,130 D66G probably damaging Het
Fzd10 G A 5: 128,602,412 V399M probably damaging Het
Gm10801 T A 2: 98,664,016 I146N possibly damaging Het
Gm20767 G A 13: 120,154,832 C69Y probably damaging Het
Gm436 C T 4: 144,670,128 E345K probably damaging Het
Gm525 T A 11: 89,075,004 probably null Het
Gpr37l1 T C 1: 135,161,362 I322V probably benign Het
Grid2ip T G 5: 143,386,039 S679R probably damaging Het
Gyg A T 3: 20,155,025 S15T probably benign Het
Hace1 G A 10: 45,711,508 C901Y probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hp1bp3 C T 4: 138,221,707 A27V probably benign Het
Hsf5 A G 11: 87,631,682 Y367C probably damaging Het
Igf2r T C 17: 12,705,829 I1034V probably benign Het
Itpr1 A G 6: 108,394,841 T1159A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc14 T C 15: 76,713,565 V165A probably benign Het
Lrrc45 C T 11: 120,718,677 A422V probably benign Het
Lrrk2 T A 15: 91,767,461 probably null Het
Map3k4 T C 17: 12,235,993 H1370R possibly damaging Het
Mpo A G 11: 87,801,040 Y433C probably damaging Het
Nfkbil1 G T 17: 35,220,956 Q194K probably benign Het
Nin C T 12: 70,078,242 G102E probably damaging Het
Nmt1 T C 11: 103,052,233 V138A probably benign Het
Olfr1215 A G 2: 89,002,033 F85S probably benign Het
Olfr430 T A 1: 174,069,581 F94L probably damaging Het
Olfr432 A T 1: 174,050,510 I46F probably damaging Het
Olfr629 A C 7: 103,740,587 Y218D probably damaging Het
Optc T A 1: 133,901,182 R176* probably null Het
Oxct1 T A 15: 4,037,119 N72K possibly damaging Het
Plxna2 G A 1: 194,794,910 A1243T probably benign Het
Rin1 G T 19: 5,052,974 L430F probably benign Het
Ros1 A T 10: 52,194,848 S37T possibly damaging Het
Rrp36 G T 17: 46,672,806 Q27K probably damaging Het
Sez6 T C 11: 77,976,882 I875T probably damaging Het
Sfrp5 T G 19: 42,201,818 Y65S probably damaging Het
Slc35d3 T C 10: 19,848,859 E417G probably damaging Het
Sumf2 A G 5: 129,849,979 D52G probably benign Het
Sympk A G 7: 19,047,522 N801S possibly damaging Het
Tmem38b T C 4: 53,854,398 F210S probably damaging Het
Tnks T A 8: 34,940,812 H254L probably damaging Het
Trappc10 A T 10: 78,210,403 V451E probably benign Het
Trim43a A T 9: 88,583,078 I153F probably benign Het
Tulp1 T C 17: 28,353,709 N213S probably damaging Het
Ubr1 T C 2: 120,916,470 D830G probably benign Het
Uqcc3 C T 19: 8,880,705 probably null Het
Vmn2r26 T A 6: 124,025,979 M116K probably benign Het
Zscan12 A G 13: 21,368,630 Q208R probably benign Het
Other mutations in Slc25a54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Slc25a54 APN 3 109112860 missense possibly damaging 0.76
IGL02635:Slc25a54 APN 3 109112817 missense possibly damaging 0.71
IGL02944:Slc25a54 APN 3 109080615 missense probably benign 0.14
IGL02987:Slc25a54 APN 3 109116337 missense probably benign
IGL03346:Slc25a54 APN 3 109085730 intron probably benign
R0491:Slc25a54 UTSW 3 109102796 missense probably damaging 1.00
R0520:Slc25a54 UTSW 3 109107230 splice site probably benign
R0645:Slc25a54 UTSW 3 109112165 missense possibly damaging 0.70
R1803:Slc25a54 UTSW 3 109102697 missense probably benign
R1869:Slc25a54 UTSW 3 109080616 nonsense probably null
R1870:Slc25a54 UTSW 3 109080616 nonsense probably null
R3024:Slc25a54 UTSW 3 109080666 missense probably damaging 1.00
R3763:Slc25a54 UTSW 3 109112054 missense probably damaging 1.00
R3941:Slc25a54 UTSW 3 109112163 missense probably damaging 1.00
R4346:Slc25a54 UTSW 3 109102739 missense possibly damaging 0.52
R4347:Slc25a54 UTSW 3 109102739 missense possibly damaging 0.52
R4445:Slc25a54 UTSW 3 109098668 missense probably benign 0.00
R4735:Slc25a54 UTSW 3 109098607 missense probably damaging 0.96
R4914:Slc25a54 UTSW 3 109111079 missense probably benign 0.34
R4960:Slc25a54 UTSW 3 109112816 missense possibly damaging 0.95
R5052:Slc25a54 UTSW 3 109102700 missense probably benign 0.03
R5106:Slc25a54 UTSW 3 109112864 missense probably benign 0.02
R5806:Slc25a54 UTSW 3 109080578 missense probably benign
R5936:Slc25a54 UTSW 3 109098638 missense possibly damaging 0.88
R6511:Slc25a54 UTSW 3 109094256 missense possibly damaging 0.92
R6532:Slc25a54 UTSW 3 109112052 missense probably damaging 1.00
R6879:Slc25a54 UTSW 3 109112834 missense possibly damaging 0.94
R7139:Slc25a54 UTSW 3 109098589 missense probably damaging 1.00
R7179:Slc25a54 UTSW 3 109107257 missense probably benign 0.00
R7282:Slc25a54 UTSW 3 109116501 nonsense probably null
R7336:Slc25a54 UTSW 3 109116435 missense probably benign 0.00
R7355:Slc25a54 UTSW 3 109102769 missense probably damaging 1.00
R7713:Slc25a54 UTSW 3 109102817 missense probably damaging 0.99
R8061:Slc25a54 UTSW 3 109111045 missense probably damaging 1.00
R8282:Slc25a54 UTSW 3 109098689 critical splice donor site probably null
Z1176:Slc25a54 UTSW 3 109112118 frame shift probably null
Z1177:Slc25a54 UTSW 3 109102797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAGTCATGCTGGAAAAGGAAAC -3'
(R):5'- GCCTACCAAGTGTTTCCTAATG -3'

Sequencing Primer
(F):5'- ACAGTGCGCATGATGCAGC -3'
(R):5'- TAGGAATGCATTACACCATCGAATC -3'
Posted On2015-04-17