Incidental Mutation 'R3930:Vmn2r26'
ID 308421
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 040917-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R3930 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124002938 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 116 (M116K)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: M116K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: M116K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 C T 4: 144,396,698 (GRCm39) E345K probably damaging Het
Bpifb1 A G 2: 154,057,242 (GRCm39) N400S possibly damaging Het
Cep250 G A 2: 155,834,552 (GRCm39) R2159K probably damaging Het
Crhr1 T A 11: 104,044,377 (GRCm39) S22T probably benign Het
Cyp4a10 G T 4: 115,381,980 (GRCm39) V221L probably benign Het
D1Pas1 G T 1: 186,700,477 (GRCm39) W135C probably damaging Het
Dcbld2 T C 16: 58,285,701 (GRCm39) L620P probably damaging Het
Dnah17 C T 11: 117,971,675 (GRCm39) probably benign Het
Dnm3 T C 1: 161,911,699 (GRCm39) D66G probably damaging Het
Fzd10 G A 5: 128,679,476 (GRCm39) V399M probably damaging Het
Gm10801 T A 2: 98,494,361 (GRCm39) I146N possibly damaging Het
Gm525 T A 11: 88,965,830 (GRCm39) probably null Het
Gpr37l1 T C 1: 135,089,100 (GRCm39) I322V probably benign Het
Grid2ip T G 5: 143,371,794 (GRCm39) S679R probably damaging Het
Gyg1 A T 3: 20,209,189 (GRCm39) S15T probably benign Het
Hace1 G A 10: 45,587,604 (GRCm39) C901Y probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hp1bp3 C T 4: 137,949,018 (GRCm39) A27V probably benign Het
Hsf5 A G 11: 87,522,508 (GRCm39) Y367C probably damaging Het
Igf2r T C 17: 12,924,716 (GRCm39) I1034V probably benign Het
Itpr1 A G 6: 108,371,802 (GRCm39) T1159A probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lrrc14 T C 15: 76,597,765 (GRCm39) V165A probably benign Het
Lrrc45 C T 11: 120,609,503 (GRCm39) A422V probably benign Het
Lrrk2 T A 15: 91,651,664 (GRCm39) probably null Het
Map3k4 T C 17: 12,454,880 (GRCm39) H1370R possibly damaging Het
Mpo A G 11: 87,691,866 (GRCm39) Y433C probably damaging Het
Nfkbil1 G T 17: 35,439,932 (GRCm39) Q194K probably benign Het
Nin C T 12: 70,125,016 (GRCm39) G102E probably damaging Het
Nmt1 T C 11: 102,943,059 (GRCm39) V138A probably benign Het
Optc T A 1: 133,828,920 (GRCm39) R176* probably null Het
Or10aa3 A T 1: 173,878,076 (GRCm39) I46F probably damaging Het
Or4c110 A G 2: 88,832,377 (GRCm39) F85S probably benign Het
Or52ae9 A C 7: 103,389,794 (GRCm39) Y218D probably damaging Het
Or6n2 T A 1: 173,897,147 (GRCm39) F94L probably damaging Het
Oxct1 T A 15: 4,066,601 (GRCm39) N72K possibly damaging Het
Plxna2 G A 1: 194,477,218 (GRCm39) A1243T probably benign Het
Rin1 G T 19: 5,103,002 (GRCm39) L430F probably benign Het
Ros1 A T 10: 52,070,944 (GRCm39) S37T possibly damaging Het
Rrp36 G T 17: 46,983,732 (GRCm39) Q27K probably damaging Het
Sez6 T C 11: 77,867,708 (GRCm39) I875T probably damaging Het
Sfrp5 T G 19: 42,190,257 (GRCm39) Y65S probably damaging Het
Slc25a54 T A 3: 109,023,820 (GRCm39) L472I probably benign Het
Slc35d3 T C 10: 19,724,605 (GRCm39) E417G probably damaging Het
Sumf2 A G 5: 129,878,820 (GRCm39) D52G probably benign Het
Sympk A G 7: 18,781,447 (GRCm39) N801S possibly damaging Het
Taf7l2 G T 10: 115,948,540 (GRCm39) Q329K possibly damaging Het
Tcstv2c G A 13: 120,616,368 (GRCm39) C69Y probably damaging Het
Tmem38b T C 4: 53,854,398 (GRCm39) F210S probably damaging Het
Tnks T A 8: 35,407,966 (GRCm39) H254L probably damaging Het
Trappc10 A T 10: 78,046,237 (GRCm39) V451E probably benign Het
Trim43a A T 9: 88,465,131 (GRCm39) I153F probably benign Het
Tulp1 T C 17: 28,572,683 (GRCm39) N213S probably damaging Het
Ubr1 T C 2: 120,746,951 (GRCm39) D830G probably benign Het
Uqcc3 C T 19: 8,858,069 (GRCm39) probably null Het
Zscan12 A G 13: 21,552,800 (GRCm39) Q208R probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124,038,704 (GRCm39) missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCTCTTTATATGCCTTAGATTGCTG -3'
(R):5'- ACCTGTGGGACGTTGTAGAG -3'

Sequencing Primer
(F):5'- TCCAAAATTTGAGAGGGAGCACTG -3'
(R):5'- CGTTGTAGAGACTTAGAACTCGG -3'
Posted On 2015-04-17