Incidental Mutation 'R3930:Vmn2r26'
ID308421
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Namevomeronasal 2, receptor 26
SynonymsV2r1b
MMRRC Submission 040917-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R3930 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124024758-124062035 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124025979 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 116 (M116K)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
Predicted Effect probably benign
Transcript: ENSMUST00000032238
AA Change: M116K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: M116K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik G T 10: 116,112,635 Q329K possibly damaging Het
Bpifb1 A G 2: 154,215,322 N400S possibly damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Crhr1 T A 11: 104,153,551 S22T probably benign Het
Cyp4a10 G T 4: 115,524,783 V221L probably benign Het
D1Pas1 G T 1: 186,968,280 W135C probably damaging Het
Dcbld2 T C 16: 58,465,338 L620P probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnm3 T C 1: 162,084,130 D66G probably damaging Het
Fzd10 G A 5: 128,602,412 V399M probably damaging Het
Gm10801 T A 2: 98,664,016 I146N possibly damaging Het
Gm20767 G A 13: 120,154,832 C69Y probably damaging Het
Gm436 C T 4: 144,670,128 E345K probably damaging Het
Gm525 T A 11: 89,075,004 probably null Het
Gpr37l1 T C 1: 135,161,362 I322V probably benign Het
Grid2ip T G 5: 143,386,039 S679R probably damaging Het
Gyg A T 3: 20,155,025 S15T probably benign Het
Hace1 G A 10: 45,711,508 C901Y probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hp1bp3 C T 4: 138,221,707 A27V probably benign Het
Hsf5 A G 11: 87,631,682 Y367C probably damaging Het
Igf2r T C 17: 12,705,829 I1034V probably benign Het
Itpr1 A G 6: 108,394,841 T1159A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc14 T C 15: 76,713,565 V165A probably benign Het
Lrrc45 C T 11: 120,718,677 A422V probably benign Het
Lrrk2 T A 15: 91,767,461 probably null Het
Map3k4 T C 17: 12,235,993 H1370R possibly damaging Het
Mpo A G 11: 87,801,040 Y433C probably damaging Het
Nfkbil1 G T 17: 35,220,956 Q194K probably benign Het
Nin C T 12: 70,078,242 G102E probably damaging Het
Nmt1 T C 11: 103,052,233 V138A probably benign Het
Olfr1215 A G 2: 89,002,033 F85S probably benign Het
Olfr430 T A 1: 174,069,581 F94L probably damaging Het
Olfr432 A T 1: 174,050,510 I46F probably damaging Het
Olfr629 A C 7: 103,740,587 Y218D probably damaging Het
Optc T A 1: 133,901,182 R176* probably null Het
Oxct1 T A 15: 4,037,119 N72K possibly damaging Het
Plxna2 G A 1: 194,794,910 A1243T probably benign Het
Rin1 G T 19: 5,052,974 L430F probably benign Het
Ros1 A T 10: 52,194,848 S37T possibly damaging Het
Rrp36 G T 17: 46,672,806 Q27K probably damaging Het
Sez6 T C 11: 77,976,882 I875T probably damaging Het
Sfrp5 T G 19: 42,201,818 Y65S probably damaging Het
Slc25a54 T A 3: 109,116,504 L472I probably benign Het
Slc35d3 T C 10: 19,848,859 E417G probably damaging Het
Sumf2 A G 5: 129,849,979 D52G probably benign Het
Sympk A G 7: 19,047,522 N801S possibly damaging Het
Tmem38b T C 4: 53,854,398 F210S probably damaging Het
Tnks T A 8: 34,940,812 H254L probably damaging Het
Trappc10 A T 10: 78,210,403 V451E probably benign Het
Trim43a A T 9: 88,583,078 I153F probably benign Het
Tulp1 T C 17: 28,353,709 N213S probably damaging Het
Ubr1 T C 2: 120,916,470 D830G probably benign Het
Uqcc3 C T 19: 8,880,705 probably null Het
Zscan12 A G 13: 21,368,630 Q208R probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7716:Vmn2r26 UTSW 6 124061745 missense probably damaging 1.00
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124061928 missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124026036 missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GCTCTTTATATGCCTTAGATTGCTG -3'
(R):5'- ACCTGTGGGACGTTGTAGAG -3'

Sequencing Primer
(F):5'- TCCAAAATTTGAGAGGGAGCACTG -3'
(R):5'- CGTTGTAGAGACTTAGAACTCGG -3'
Posted On2015-04-17