Incidental Mutation 'R3930:Sympk'
ID308422
Institutional Source Beutler Lab
Gene Symbol Sympk
Ensembl Gene ENSMUSG00000023118
Gene Namesymplekin
Synonyms
MMRRC Submission 040917-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R3930 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19024377-19054618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19047522 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 801 (N801S)
Ref Sequence ENSEMBL: ENSMUSP00000023882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023882] [ENSMUST00000146903]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023882
AA Change: N801S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023882
Gene: ENSMUSG00000023118
AA Change: N801S

DomainStartEndE-ValueType
low complexity region 106 118 N/A INTRINSIC
Pfam:DUF3453 119 352 1.1e-63 PFAM
low complexity region 473 485 N/A INTRINSIC
Pfam:Symplekin_C 887 1068 4.3e-78 PFAM
low complexity region 1123 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130328
SMART Domains Protein: ENSMUSP00000115900
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:Symplekin_C 1 92 3.9e-44 PFAM
low complexity region 125 143 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138440
Predicted Effect probably benign
Transcript: ENSMUST00000146903
SMART Domains Protein: ENSMUSP00000138740
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:DUF3453 117 230 1.1e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148861
Meta Mutation Damage Score 0.1701 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that functions in the regulation of polyadenylation and promotes gene expression. The protein forms a high-molecular weight complex with components of the polyadenylation machinery. It is thought to serve as a scaffold for recruiting regulatory factors to the polyadenylation complex. It also participates in 3'-end maturation of histone mRNAs, which do not undergo polyadenylation. The protein also localizes to the cytoplasmic plaques of tight junctions in some cell types. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous ofr a transgenic gene disruption exhibit anemia at E15 and hydrops fetalis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik G T 10: 116,112,635 Q329K possibly damaging Het
Bpifb1 A G 2: 154,215,322 N400S possibly damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Crhr1 T A 11: 104,153,551 S22T probably benign Het
Cyp4a10 G T 4: 115,524,783 V221L probably benign Het
D1Pas1 G T 1: 186,968,280 W135C probably damaging Het
Dcbld2 T C 16: 58,465,338 L620P probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnm3 T C 1: 162,084,130 D66G probably damaging Het
Fzd10 G A 5: 128,602,412 V399M probably damaging Het
Gm10801 T A 2: 98,664,016 I146N possibly damaging Het
Gm20767 G A 13: 120,154,832 C69Y probably damaging Het
Gm436 C T 4: 144,670,128 E345K probably damaging Het
Gm525 T A 11: 89,075,004 probably null Het
Gpr37l1 T C 1: 135,161,362 I322V probably benign Het
Grid2ip T G 5: 143,386,039 S679R probably damaging Het
Gyg A T 3: 20,155,025 S15T probably benign Het
Hace1 G A 10: 45,711,508 C901Y probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hp1bp3 C T 4: 138,221,707 A27V probably benign Het
Hsf5 A G 11: 87,631,682 Y367C probably damaging Het
Igf2r T C 17: 12,705,829 I1034V probably benign Het
Itpr1 A G 6: 108,394,841 T1159A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc14 T C 15: 76,713,565 V165A probably benign Het
Lrrc45 C T 11: 120,718,677 A422V probably benign Het
Lrrk2 T A 15: 91,767,461 probably null Het
Map3k4 T C 17: 12,235,993 H1370R possibly damaging Het
Mpo A G 11: 87,801,040 Y433C probably damaging Het
Nfkbil1 G T 17: 35,220,956 Q194K probably benign Het
Nin C T 12: 70,078,242 G102E probably damaging Het
Nmt1 T C 11: 103,052,233 V138A probably benign Het
Olfr1215 A G 2: 89,002,033 F85S probably benign Het
Olfr430 T A 1: 174,069,581 F94L probably damaging Het
Olfr432 A T 1: 174,050,510 I46F probably damaging Het
Olfr629 A C 7: 103,740,587 Y218D probably damaging Het
Optc T A 1: 133,901,182 R176* probably null Het
Oxct1 T A 15: 4,037,119 N72K possibly damaging Het
Plxna2 G A 1: 194,794,910 A1243T probably benign Het
Rin1 G T 19: 5,052,974 L430F probably benign Het
Ros1 A T 10: 52,194,848 S37T possibly damaging Het
Rrp36 G T 17: 46,672,806 Q27K probably damaging Het
Sez6 T C 11: 77,976,882 I875T probably damaging Het
Sfrp5 T G 19: 42,201,818 Y65S probably damaging Het
Slc25a54 T A 3: 109,116,504 L472I probably benign Het
Slc35d3 T C 10: 19,848,859 E417G probably damaging Het
Sumf2 A G 5: 129,849,979 D52G probably benign Het
Tmem38b T C 4: 53,854,398 F210S probably damaging Het
Tnks T A 8: 34,940,812 H254L probably damaging Het
Trappc10 A T 10: 78,210,403 V451E probably benign Het
Trim43a A T 9: 88,583,078 I153F probably benign Het
Tulp1 T C 17: 28,353,709 N213S probably damaging Het
Ubr1 T C 2: 120,916,470 D830G probably benign Het
Uqcc3 C T 19: 8,880,705 probably null Het
Vmn2r26 T A 6: 124,025,979 M116K probably benign Het
Zscan12 A G 13: 21,368,630 Q208R probably benign Het
Other mutations in Sympk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Sympk APN 7 19047573 missense probably benign 0.14
IGL01834:Sympk APN 7 19043435 missense probably benign 0.02
IGL02588:Sympk APN 7 19042625 missense probably benign
IGL02601:Sympk APN 7 19048869 missense probably benign 0.31
IGL02645:Sympk APN 7 19052424 missense probably damaging 0.99
IGL02698:Sympk APN 7 19045634 missense probably benign 0.35
IGL02709:Sympk APN 7 19047538 missense probably benign 0.26
IGL02814:Sympk APN 7 19053273 missense probably damaging 1.00
IGL03198:Sympk APN 7 19044996 missense possibly damaging 0.92
butterfinger UTSW 7 19048453 missense probably damaging 0.98
fifth_avenue UTSW 7 19043460 missense possibly damaging 0.83
IGL02991:Sympk UTSW 7 19030577 missense probably damaging 1.00
R0391:Sympk UTSW 7 19046849 missense probably benign 0.06
R1036:Sympk UTSW 7 19048453 missense probably damaging 0.98
R1872:Sympk UTSW 7 19029145 missense probably benign
R2058:Sympk UTSW 7 19043529 missense probably damaging 1.00
R2103:Sympk UTSW 7 19054116 missense probably benign
R2966:Sympk UTSW 7 19030544 missense probably damaging 1.00
R3110:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3112:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3703:Sympk UTSW 7 19040561 missense probably damaging 0.99
R3775:Sympk UTSW 7 19035955 missense probably damaging 1.00
R4638:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4639:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4645:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4688:Sympk UTSW 7 19054410 missense probably benign
R5050:Sympk UTSW 7 19036042 missense probably benign 0.19
R5051:Sympk UTSW 7 19036042 missense probably benign 0.19
R5052:Sympk UTSW 7 19036042 missense probably benign 0.19
R5092:Sympk UTSW 7 19042659 missense probably benign 0.17
R5211:Sympk UTSW 7 19035889 missense probably benign 0.22
R5591:Sympk UTSW 7 19054039 missense probably damaging 1.00
R5678:Sympk UTSW 7 19049472 critical splice donor site probably null
R5972:Sympk UTSW 7 19046824 missense probably benign
R6387:Sympk UTSW 7 19052498 missense possibly damaging 0.94
R6543:Sympk UTSW 7 19036830 missense probably damaging 1.00
R6984:Sympk UTSW 7 19038043 missense probably benign 0.00
R7141:Sympk UTSW 7 19054092 missense probably benign
R7292:Sympk UTSW 7 19036030 missense probably benign 0.01
R7319:Sympk UTSW 7 19035845 missense probably benign
R7887:Sympk UTSW 7 19034439 missense possibly damaging 0.69
R8094:Sympk UTSW 7 19053448 critical splice donor site probably null
R8147:Sympk UTSW 7 19036793 missense probably damaging 0.98
RF064:Sympk UTSW 7 19034395 frame shift probably null
X0017:Sympk UTSW 7 19040663 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CAGGGTTAGCTTCGCACATC -3'
(R):5'- GCACTATGCCTCCCTACATG -3'

Sequencing Primer
(F):5'- ACATCTTCCCACTGACTTCACTGAG -3'
(R):5'- GCCTCCCTACATGTTGAAGAATGTG -3'
Posted On2015-04-17