Incidental Mutation 'R3930:Tnks'
ID 308424
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Name tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms mTNKS1, TANK1, tankyrase 1, 4930554K12Rik, D130072O21Rik
MMRRC Submission 040917-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3930 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 35296333-35432844 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 35407966 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 254 (H254L)
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
AlphaFold Q6PFX9
PDB Structure Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000033929
AA Change: H254L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: H254L

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Meta Mutation Damage Score 0.9537 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 C T 4: 144,396,698 (GRCm39) E345K probably damaging Het
Bpifb1 A G 2: 154,057,242 (GRCm39) N400S possibly damaging Het
Cep250 G A 2: 155,834,552 (GRCm39) R2159K probably damaging Het
Crhr1 T A 11: 104,044,377 (GRCm39) S22T probably benign Het
Cyp4a10 G T 4: 115,381,980 (GRCm39) V221L probably benign Het
D1Pas1 G T 1: 186,700,477 (GRCm39) W135C probably damaging Het
Dcbld2 T C 16: 58,285,701 (GRCm39) L620P probably damaging Het
Dnah17 C T 11: 117,971,675 (GRCm39) probably benign Het
Dnm3 T C 1: 161,911,699 (GRCm39) D66G probably damaging Het
Fzd10 G A 5: 128,679,476 (GRCm39) V399M probably damaging Het
Gm10801 T A 2: 98,494,361 (GRCm39) I146N possibly damaging Het
Gm525 T A 11: 88,965,830 (GRCm39) probably null Het
Gpr37l1 T C 1: 135,089,100 (GRCm39) I322V probably benign Het
Grid2ip T G 5: 143,371,794 (GRCm39) S679R probably damaging Het
Gyg1 A T 3: 20,209,189 (GRCm39) S15T probably benign Het
Hace1 G A 10: 45,587,604 (GRCm39) C901Y probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hp1bp3 C T 4: 137,949,018 (GRCm39) A27V probably benign Het
Hsf5 A G 11: 87,522,508 (GRCm39) Y367C probably damaging Het
Igf2r T C 17: 12,924,716 (GRCm39) I1034V probably benign Het
Itpr1 A G 6: 108,371,802 (GRCm39) T1159A probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lrrc14 T C 15: 76,597,765 (GRCm39) V165A probably benign Het
Lrrc45 C T 11: 120,609,503 (GRCm39) A422V probably benign Het
Lrrk2 T A 15: 91,651,664 (GRCm39) probably null Het
Map3k4 T C 17: 12,454,880 (GRCm39) H1370R possibly damaging Het
Mpo A G 11: 87,691,866 (GRCm39) Y433C probably damaging Het
Nfkbil1 G T 17: 35,439,932 (GRCm39) Q194K probably benign Het
Nin C T 12: 70,125,016 (GRCm39) G102E probably damaging Het
Nmt1 T C 11: 102,943,059 (GRCm39) V138A probably benign Het
Optc T A 1: 133,828,920 (GRCm39) R176* probably null Het
Or10aa3 A T 1: 173,878,076 (GRCm39) I46F probably damaging Het
Or4c110 A G 2: 88,832,377 (GRCm39) F85S probably benign Het
Or52ae9 A C 7: 103,389,794 (GRCm39) Y218D probably damaging Het
Or6n2 T A 1: 173,897,147 (GRCm39) F94L probably damaging Het
Oxct1 T A 15: 4,066,601 (GRCm39) N72K possibly damaging Het
Plxna2 G A 1: 194,477,218 (GRCm39) A1243T probably benign Het
Rin1 G T 19: 5,103,002 (GRCm39) L430F probably benign Het
Ros1 A T 10: 52,070,944 (GRCm39) S37T possibly damaging Het
Rrp36 G T 17: 46,983,732 (GRCm39) Q27K probably damaging Het
Sez6 T C 11: 77,867,708 (GRCm39) I875T probably damaging Het
Sfrp5 T G 19: 42,190,257 (GRCm39) Y65S probably damaging Het
Slc25a54 T A 3: 109,023,820 (GRCm39) L472I probably benign Het
Slc35d3 T C 10: 19,724,605 (GRCm39) E417G probably damaging Het
Sumf2 A G 5: 129,878,820 (GRCm39) D52G probably benign Het
Sympk A G 7: 18,781,447 (GRCm39) N801S possibly damaging Het
Taf7l2 G T 10: 115,948,540 (GRCm39) Q329K possibly damaging Het
Tcstv2c G A 13: 120,616,368 (GRCm39) C69Y probably damaging Het
Tmem38b T C 4: 53,854,398 (GRCm39) F210S probably damaging Het
Trappc10 A T 10: 78,046,237 (GRCm39) V451E probably benign Het
Trim43a A T 9: 88,465,131 (GRCm39) I153F probably benign Het
Tulp1 T C 17: 28,572,683 (GRCm39) N213S probably damaging Het
Ubr1 T C 2: 120,746,951 (GRCm39) D830G probably benign Het
Uqcc3 C T 19: 8,858,069 (GRCm39) probably null Het
Vmn2r26 T A 6: 124,002,938 (GRCm39) M116K probably benign Het
Zscan12 A G 13: 21,552,800 (GRCm39) Q208R probably benign Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 35,328,843 (GRCm39) splice site probably benign
IGL00901:Tnks APN 8 35,305,549 (GRCm39) nonsense probably null
IGL01448:Tnks APN 8 35,307,136 (GRCm39) missense probably damaging 1.00
IGL01455:Tnks APN 8 35,408,054 (GRCm39) missense probably damaging 0.99
IGL01962:Tnks APN 8 35,336,678 (GRCm39) missense probably damaging 1.00
IGL02088:Tnks APN 8 35,307,148 (GRCm39) missense possibly damaging 0.50
IGL02260:Tnks APN 8 35,310,137 (GRCm39) missense probably damaging 0.99
IGL02454:Tnks APN 8 35,298,882 (GRCm39) unclassified probably benign
IGL02486:Tnks APN 8 35,318,352 (GRCm39) missense probably damaging 1.00
IGL02612:Tnks APN 8 35,316,453 (GRCm39) missense possibly damaging 0.48
IGL03179:Tnks APN 8 35,315,824 (GRCm39) missense probably benign 0.38
IGL03404:Tnks APN 8 35,407,858 (GRCm39) missense probably damaging 1.00
R0256:Tnks UTSW 8 35,328,701 (GRCm39) missense probably benign 0.07
R0265:Tnks UTSW 8 35,307,124 (GRCm39) nonsense probably null
R0334:Tnks UTSW 8 35,320,413 (GRCm39) nonsense probably null
R0414:Tnks UTSW 8 35,320,463 (GRCm39) missense probably damaging 1.00
R0526:Tnks UTSW 8 35,320,457 (GRCm39) missense probably benign 0.23
R0622:Tnks UTSW 8 35,407,976 (GRCm39) missense probably damaging 1.00
R1445:Tnks UTSW 8 35,301,757 (GRCm39) splice site probably benign
R1618:Tnks UTSW 8 35,342,430 (GRCm39) missense probably damaging 1.00
R1779:Tnks UTSW 8 35,324,672 (GRCm39) missense probably benign 0.18
R1919:Tnks UTSW 8 35,342,386 (GRCm39) missense probably damaging 1.00
R1938:Tnks UTSW 8 35,305,684 (GRCm39) missense probably damaging 1.00
R2018:Tnks UTSW 8 35,318,260 (GRCm39) missense probably damaging 1.00
R2198:Tnks UTSW 8 35,340,221 (GRCm39) missense probably benign 0.29
R2198:Tnks UTSW 8 35,315,803 (GRCm39) missense probably benign
R2925:Tnks UTSW 8 35,432,815 (GRCm39) missense unknown
R3828:Tnks UTSW 8 35,340,332 (GRCm39) missense probably damaging 1.00
R3913:Tnks UTSW 8 35,340,228 (GRCm39) missense probably damaging 0.99
R3916:Tnks UTSW 8 35,320,515 (GRCm39) missense probably damaging 1.00
R3917:Tnks UTSW 8 35,320,515 (GRCm39) missense probably damaging 1.00
R4659:Tnks UTSW 8 35,316,465 (GRCm39) missense possibly damaging 0.53
R4760:Tnks UTSW 8 35,318,937 (GRCm39) missense probably benign 0.38
R5091:Tnks UTSW 8 35,308,963 (GRCm39) missense probably benign 0.40
R5419:Tnks UTSW 8 35,432,720 (GRCm39) missense unknown
R5558:Tnks UTSW 8 35,432,819 (GRCm39) start codon destroyed probably null
R5582:Tnks UTSW 8 35,408,015 (GRCm39) missense probably benign 0.14
R6035:Tnks UTSW 8 35,385,615 (GRCm39) missense possibly damaging 0.93
R6035:Tnks UTSW 8 35,385,615 (GRCm39) missense possibly damaging 0.93
R6495:Tnks UTSW 8 35,307,120 (GRCm39) critical splice donor site probably null
R6527:Tnks UTSW 8 35,340,247 (GRCm39) missense probably benign 0.36
R6991:Tnks UTSW 8 35,301,647 (GRCm39) missense probably damaging 1.00
R7015:Tnks UTSW 8 35,305,701 (GRCm39) missense probably benign 0.04
R7038:Tnks UTSW 8 35,318,790 (GRCm39) missense probably damaging 0.99
R7057:Tnks UTSW 8 35,307,168 (GRCm39) missense probably damaging 1.00
R7167:Tnks UTSW 8 35,316,458 (GRCm39) missense probably damaging 0.98
R7250:Tnks UTSW 8 35,318,912 (GRCm39) missense probably damaging 0.98
R7475:Tnks UTSW 8 35,298,866 (GRCm39) missense probably damaging 1.00
R7790:Tnks UTSW 8 35,328,694 (GRCm39) missense probably benign 0.01
R7818:Tnks UTSW 8 35,340,182 (GRCm39) missense probably benign 0.03
R7909:Tnks UTSW 8 35,407,858 (GRCm39) missense probably damaging 1.00
R7970:Tnks UTSW 8 35,323,080 (GRCm39) critical splice donor site probably null
R8341:Tnks UTSW 8 35,340,199 (GRCm39) missense probably damaging 1.00
R8343:Tnks UTSW 8 35,301,738 (GRCm39) missense probably benign 0.03
R8870:Tnks UTSW 8 35,314,433 (GRCm39) critical splice donor site probably null
R8936:Tnks UTSW 8 35,320,501 (GRCm39) nonsense probably null
R9049:Tnks UTSW 8 35,308,932 (GRCm39) missense probably damaging 0.96
R9080:Tnks UTSW 8 35,432,466 (GRCm39) small deletion probably benign
R9182:Tnks UTSW 8 35,308,905 (GRCm39) critical splice donor site probably null
R9211:Tnks UTSW 8 35,316,489 (GRCm39) missense probably damaging 1.00
R9425:Tnks UTSW 8 35,340,819 (GRCm39) missense probably damaging 1.00
R9649:Tnks UTSW 8 35,306,089 (GRCm39) missense probably damaging 0.96
Z1177:Tnks UTSW 8 35,432,299 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCCTCTAGAAGCCATACGCC -3'
(R):5'- CATGGGTGTGGACCTCGTTAAG -3'

Sequencing Primer
(F):5'- ATACGCCCTTACATATGCTGAGG -3'
(R):5'- CAGATGGGTGCTAATGTC -3'
Posted On 2015-04-17