Incidental Mutation 'R0379:March7'
ID30843
Institutional Source Beutler Lab
Gene Symbol March7
Ensembl Gene ENSMUSG00000026977
Gene Namemembrane-associated ring finger (C3HC4) 7
SynonymsAxot, Gtrgeo17
MMRRC Submission 038585-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.324) question?
Stock #R0379 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location60209887-60250676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60234126 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 249 (S249P)
Ref Sequence ENSEMBL: ENSMUSP00000099809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067542] [ENSMUST00000102747] [ENSMUST00000102748]
Predicted Effect probably benign
Transcript: ENSMUST00000067542
AA Change: S249P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000068961
Gene: ENSMUSG00000026977
AA Change: S249P

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102747
AA Change: S249P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099808
Gene: ENSMUSG00000026977
AA Change: S249P

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102748
AA Change: S249P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099809
Gene: ENSMUSG00000026977
AA Change: S249P

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
low complexity region 139 152 N/A INTRINSIC
low complexity region 216 234 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
RINGv 553 610 2.11e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134905
Predicted Effect probably benign
Transcript: ENSMUST00000142485
SMART Domains Protein: ENSMUSP00000116925
Gene: ENSMUSG00000026977

DomainStartEndE-ValueType
RINGv 15 72 2.11e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143806
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH7 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments (Bartee et al., 2004 [PubMed 14722266]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Homozygous null mice show premature neural degeneration and defective development of the corpus callosum. Both T cell proliferation and T cell-derived leukaemia inhibitory factor are increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C T 2: 130,785,546 probably benign Het
4930512M02Rik A G 11: 11,589,365 probably benign Het
Apba1 A C 19: 23,934,830 N558T probably damaging Het
Arfgef2 T A 2: 166,860,400 probably null Het
Arsb T C 13: 93,940,627 S501P probably benign Het
Atp10b A G 11: 43,254,314 T1295A probably benign Het
Atp8b5 G T 4: 43,361,898 R648L probably damaging Het
Bcl2a1b T C 9: 89,199,736 I126T possibly damaging Het
Brd9 T C 13: 73,942,683 probably benign Het
Cd93 T C 2: 148,441,510 probably benign Het
Chd5 A G 4: 152,383,321 K1692R probably benign Het
Clcn4 T C 7: 7,296,792 T13A probably damaging Het
Clec14a A G 12: 58,268,794 F14S possibly damaging Het
Clec4g A G 8: 3,718,440 V97A probably benign Het
Col24a1 G A 3: 145,524,142 R1483K possibly damaging Het
Crem A T 18: 3,299,226 V82D probably damaging Het
Ctnna2 T A 6: 77,641,440 T180S probably benign Het
Cybrd1 T C 2: 71,129,755 I99T probably benign Het
Cyp4a32 G A 4: 115,621,474 V468M probably damaging Het
Dlk1 A G 12: 109,455,059 probably benign Het
Dnah7b A T 1: 46,140,176 Y1003F probably benign Het
Egfem1 A C 3: 29,668,250 E376A possibly damaging Het
Etl4 T A 2: 20,807,354 I1416K probably damaging Het
Fbxl4 A G 4: 22,386,106 T238A probably benign Het
Fer1l6 A G 15: 58,548,338 I33M probably benign Het
Fndc3a A G 14: 72,556,609 S830P probably damaging Het
Fras1 C T 5: 96,755,509 R3082* probably null Het
Galnt13 T C 2: 55,060,492 V395A possibly damaging Het
Gm10334 T G 6: 41,445,256 probably benign Het
Gpd2 C T 2: 57,345,263 T335I probably damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Hydin A G 8: 110,509,127 probably benign Het
Ints5 G T 19: 8,897,133 V819L possibly damaging Het
Klhdc10 C G 6: 30,450,670 Q292E possibly damaging Het
Lmbrd2 G A 15: 9,149,479 A67T probably benign Het
Lrp1 T G 10: 127,594,969 T404P probably damaging Het
Mcm10 T A 2: 5,008,623 K66M probably benign Het
Mtmr7 C A 8: 40,551,601 D645Y probably damaging Het
Muc6 T A 7: 141,636,955 I2602F possibly damaging Het
Myh13 G A 11: 67,369,295 probably benign Het
Myo18a G A 11: 77,850,806 V1776I possibly damaging Het
Ncapg2 T C 12: 116,443,075 L957S probably damaging Het
Ncoa3 T C 2: 166,054,502 S442P probably damaging Het
Olfr1093 G A 2: 86,785,735 E2K probably benign Het
Olfr850 T A 9: 19,477,480 T257S possibly damaging Het
Olfr986 G A 9: 40,187,433 G106D probably damaging Het
Pdcd6 G T 13: 74,309,712 N113K possibly damaging Het
Pfkfb4 C T 9: 109,027,742 probably benign Het
Pfkm A G 15: 98,126,314 H401R probably benign Het
Phldb2 C A 16: 45,781,451 D754Y probably damaging Het
Plekhb2 T A 1: 34,863,114 M49K probably damaging Het
Polrmt A G 10: 79,737,611 S1057P possibly damaging Het
Prps1l1 A G 12: 34,985,078 N64S probably benign Het
Psg16 T C 7: 17,130,658 S393P probably benign Het
Rundc1 C T 11: 101,425,147 T15I probably benign Het
Scaf11 A G 15: 96,431,816 L143S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpinf1 T G 11: 75,413,945 I197L probably benign Het
Siglec1 C T 2: 131,074,525 probably benign Het
Slc28a1 G A 7: 81,138,177 V271I probably benign Het
Sntg1 T C 1: 8,782,824 D34G probably damaging Het
Sptbn4 A T 7: 27,359,736 probably benign Het
Suclg1 T C 6: 73,256,228 I51T possibly damaging Het
Syne1 C T 10: 5,541,989 R9Q probably damaging Het
Trim47 T A 11: 116,106,518 H470L probably damaging Het
Ttc41 T A 10: 86,712,977 Y12N possibly damaging Het
Tubgcp2 T C 7: 140,032,192 E69G probably damaging Het
Tubgcp3 G A 8: 12,641,116 T474M probably damaging Het
Ubr5 A T 15: 38,018,957 N777K probably benign Het
Ush2a T C 1: 188,451,819 L1440P probably damaging Het
Usp28 A C 9: 49,024,067 D458A possibly damaging Het
Vcan A T 13: 89,703,546 D1098E probably damaging Het
Vmn1r73 C T 7: 11,756,846 T197I probably benign Het
Vmn2r15 T C 5: 109,286,478 S787G probably damaging Het
Vmn2r90 T A 17: 17,728,139 I549N probably damaging Het
Vps33b T A 7: 80,283,414 probably null Het
Zfp516 A T 18: 82,987,670 K900* probably null Het
Zfp974 T A 7: 27,910,932 N456I probably damaging Het
Other mutations in March7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:March7 APN 2 60234195 missense probably benign 0.01
IGL02001:March7 APN 2 60234891 missense possibly damaging 0.95
IGL02927:March7 APN 2 60236918 missense probably damaging 1.00
PIT4687001:March7 UTSW 2 60232278 missense probably damaging 1.00
R1722:March7 UTSW 2 60234182 missense probably damaging 1.00
R1755:March7 UTSW 2 60234921 missense probably benign
R1759:March7 UTSW 2 60234544 missense probably damaging 1.00
R1809:March7 UTSW 2 60232293 missense probably benign 0.16
R2018:March7 UTSW 2 60229040 nonsense probably null
R2226:March7 UTSW 2 60229846 missense probably benign 0.13
R2227:March7 UTSW 2 60229846 missense probably benign 0.13
R2471:March7 UTSW 2 60236900 missense possibly damaging 0.80
R3724:March7 UTSW 2 60229745 missense probably benign 0.10
R4349:March7 UTSW 2 60234195 missense probably benign 0.01
R4667:March7 UTSW 2 60241050 nonsense probably null
R5365:March7 UTSW 2 60233914 missense possibly damaging 0.48
R5524:March7 UTSW 2 60245303 intron probably benign
R5860:March7 UTSW 2 60236843 missense probably damaging 1.00
R5883:March7 UTSW 2 60234442 missense probably damaging 1.00
R5945:March7 UTSW 2 60240987 missense probably damaging 1.00
R5992:March7 UTSW 2 60245220 missense probably benign 0.14
R6937:March7 UTSW 2 60240966 missense probably damaging 1.00
R6944:March7 UTSW 2 60234243 missense probably benign 0.08
R6992:March7 UTSW 2 60229084 critical splice donor site probably null
R7337:March7 UTSW 2 60240845 splice site probably null
R7448:March7 UTSW 2 60247514 critical splice donor site probably null
R7577:March7 UTSW 2 60229704 nonsense probably null
R7712:March7 UTSW 2 60234990 nonsense probably null
R7863:March7 UTSW 2 60241022 missense probably benign 0.35
R8281:March7 UTSW 2 60234529 missense probably benign 0.02
R8469:March7 UTSW 2 60234326 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCCTAGTCTTTCAGTTTGGCAGGAG -3'
(R):5'- ACTGTGAAGTCAGGGTTCTCGGAG -3'

Sequencing Primer
(F):5'- CTTCATATTCACAGGGAGCAAG -3'
(R):5'- AGATCTTGTATTCAAGGAATCTTGAC -3'
Posted On2013-04-24