Incidental Mutation 'R3930:Mpo'
ID308433
Institutional Source Beutler Lab
Gene Symbol Mpo
Ensembl Gene ENSMUSG00000009350
Gene Namemyeloperoxidase
Synonyms
MMRRC Submission 040917-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3930 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87793581-87804413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87801040 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 433 (Y433C)
Ref Sequence ENSEMBL: ENSMUSP00000112837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020779] [ENSMUST00000107930] [ENSMUST00000121303] [ENSMUST00000143021] [ENSMUST00000146650]
Predicted Effect probably damaging
Transcript: ENSMUST00000020779
AA Change: Y433C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020779
Gene: ENSMUSG00000009350
AA Change: Y433C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:An_peroxidase 147 692 4.2e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107930
SMART Domains Protein: ENSMUSP00000103563
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
SCOP:g1cxp.1 82 99 1e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121303
AA Change: Y433C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112837
Gene: ENSMUSG00000009350
AA Change: Y433C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:An_peroxidase 147 692 4.2e-183 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130442
Predicted Effect probably benign
Transcript: ENSMUST00000143021
SMART Domains Protein: ENSMUSP00000123371
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:4C1M|B 139 167 4e-11 PDB
SCOP:g1cxp.1 141 167 4e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146650
SMART Domains Protein: ENSMUSP00000128484
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
Pfam:An_peroxidase 1 112 2.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167903
Meta Mutation Damage Score 0.9041 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myeloperoxidase (MPO) is a heme protein synthesized during myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. Produced as a single chain precursor, myeloperoxidase is subsequently cleaved into a light and heavy chain. The mature myeloperoxidase is a tetramer composed of 2 light chains and 2 heavy chains. This enzyme produces hypohalous acids central to the microbicidal activity of neutrophils. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene causes neutrophil dysfunction and decreased resistance to fungal infection with Candida, and may lead to enhanced atherosclerosis, reduced neutrophil-mediated lysis of muscle cells, decreased resistance to EAE, and altered asbestos-induced lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik G T 10: 116,112,635 Q329K possibly damaging Het
Bpifb1 A G 2: 154,215,322 N400S possibly damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Crhr1 T A 11: 104,153,551 S22T probably benign Het
Cyp4a10 G T 4: 115,524,783 V221L probably benign Het
D1Pas1 G T 1: 186,968,280 W135C probably damaging Het
Dcbld2 T C 16: 58,465,338 L620P probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnm3 T C 1: 162,084,130 D66G probably damaging Het
Fzd10 G A 5: 128,602,412 V399M probably damaging Het
Gm10801 T A 2: 98,664,016 I146N possibly damaging Het
Gm20767 G A 13: 120,154,832 C69Y probably damaging Het
Gm436 C T 4: 144,670,128 E345K probably damaging Het
Gm525 T A 11: 89,075,004 probably null Het
Gpr37l1 T C 1: 135,161,362 I322V probably benign Het
Grid2ip T G 5: 143,386,039 S679R probably damaging Het
Gyg A T 3: 20,155,025 S15T probably benign Het
Hace1 G A 10: 45,711,508 C901Y probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hp1bp3 C T 4: 138,221,707 A27V probably benign Het
Hsf5 A G 11: 87,631,682 Y367C probably damaging Het
Igf2r T C 17: 12,705,829 I1034V probably benign Het
Itpr1 A G 6: 108,394,841 T1159A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc14 T C 15: 76,713,565 V165A probably benign Het
Lrrc45 C T 11: 120,718,677 A422V probably benign Het
Lrrk2 T A 15: 91,767,461 probably null Het
Map3k4 T C 17: 12,235,993 H1370R possibly damaging Het
Nfkbil1 G T 17: 35,220,956 Q194K probably benign Het
Nin C T 12: 70,078,242 G102E probably damaging Het
Nmt1 T C 11: 103,052,233 V138A probably benign Het
Olfr1215 A G 2: 89,002,033 F85S probably benign Het
Olfr430 T A 1: 174,069,581 F94L probably damaging Het
Olfr432 A T 1: 174,050,510 I46F probably damaging Het
Olfr629 A C 7: 103,740,587 Y218D probably damaging Het
Optc T A 1: 133,901,182 R176* probably null Het
Oxct1 T A 15: 4,037,119 N72K possibly damaging Het
Plxna2 G A 1: 194,794,910 A1243T probably benign Het
Rin1 G T 19: 5,052,974 L430F probably benign Het
Ros1 A T 10: 52,194,848 S37T possibly damaging Het
Rrp36 G T 17: 46,672,806 Q27K probably damaging Het
Sez6 T C 11: 77,976,882 I875T probably damaging Het
Sfrp5 T G 19: 42,201,818 Y65S probably damaging Het
Slc25a54 T A 3: 109,116,504 L472I probably benign Het
Slc35d3 T C 10: 19,848,859 E417G probably damaging Het
Sumf2 A G 5: 129,849,979 D52G probably benign Het
Sympk A G 7: 19,047,522 N801S possibly damaging Het
Tmem38b T C 4: 53,854,398 F210S probably damaging Het
Tnks T A 8: 34,940,812 H254L probably damaging Het
Trappc10 A T 10: 78,210,403 V451E probably benign Het
Trim43a A T 9: 88,583,078 I153F probably benign Het
Tulp1 T C 17: 28,353,709 N213S probably damaging Het
Ubr1 T C 2: 120,916,470 D830G probably benign Het
Uqcc3 C T 19: 8,880,705 probably null Het
Vmn2r26 T A 6: 124,025,979 M116K probably benign Het
Zscan12 A G 13: 21,368,630 Q208R probably benign Het
Other mutations in Mpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Mpo APN 11 87802617 missense probably benign
IGL00668:Mpo APN 11 87797334 missense probably benign 0.01
IGL01016:Mpo APN 11 87797610 splice site probably null
IGL01517:Mpo APN 11 87795821 missense possibly damaging 0.83
IGL01530:Mpo APN 11 87801191 missense probably benign 0.00
IGL02123:Mpo APN 11 87794795 missense probably benign 0.05
BB001:Mpo UTSW 11 87794840 missense probably damaging 1.00
BB011:Mpo UTSW 11 87794840 missense probably damaging 1.00
R0091:Mpo UTSW 11 87801610 missense probably benign 0.06
R0458:Mpo UTSW 11 87796297 missense probably benign 0.35
R0506:Mpo UTSW 11 87803504 missense probably benign 0.00
R0574:Mpo UTSW 11 87796076 missense probably damaging 0.99
R0850:Mpo UTSW 11 87797502 missense probably damaging 1.00
R1488:Mpo UTSW 11 87797430 missense probably damaging 1.00
R1753:Mpo UTSW 11 87795881 missense probably benign 0.06
R1785:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R1891:Mpo UTSW 11 87801280 nonsense probably null
R1989:Mpo UTSW 11 87803472 missense probably damaging 1.00
R2107:Mpo UTSW 11 87796075 missense probably damaging 1.00
R2108:Mpo UTSW 11 87796075 missense probably damaging 1.00
R2130:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R2132:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R3931:Mpo UTSW 11 87801040 missense probably damaging 1.00
R3941:Mpo UTSW 11 87797349 missense probably benign 0.02
R4323:Mpo UTSW 11 87796039 missense probably damaging 1.00
R4857:Mpo UTSW 11 87796281 missense probably benign
R4892:Mpo UTSW 11 87802681 missense probably benign 0.00
R5224:Mpo UTSW 11 87796457 unclassified probably benign
R5250:Mpo UTSW 11 87803433 missense probably benign 0.03
R5373:Mpo UTSW 11 87803611 critical splice donor site probably null
R5374:Mpo UTSW 11 87803611 critical splice donor site probably null
R5408:Mpo UTSW 11 87801025 splice site probably null
R5708:Mpo UTSW 11 87801755 splice site probably null
R6354:Mpo UTSW 11 87797346 missense possibly damaging 0.89
R6598:Mpo UTSW 11 87799972 missense probably benign 0.43
R6713:Mpo UTSW 11 87795368 missense probably damaging 1.00
R7053:Mpo UTSW 11 87803510 missense probably damaging 0.99
R7395:Mpo UTSW 11 87801124 missense probably damaging 1.00
R7573:Mpo UTSW 11 87797577 missense probably benign 0.01
R7924:Mpo UTSW 11 87794840 missense probably damaging 1.00
R8152:Mpo UTSW 11 87801649 missense probably benign
R8285:Mpo UTSW 11 87797567 missense probably benign 0.05
R8776:Mpo UTSW 11 87802712 missense possibly damaging 0.50
R8776-TAIL:Mpo UTSW 11 87802712 missense possibly damaging 0.50
R8807:Mpo UTSW 11 87796339 missense probably benign 0.05
RF018:Mpo UTSW 11 87797639 missense probably damaging 1.00
Z1088:Mpo UTSW 11 87795245 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CACTAATACCTTAAAGACACGGGG -3'
(R):5'- AAGACCTTGCTGAGTGGGAC -3'

Sequencing Primer
(F):5'- TACCTTAAAGACACGGGGGATATTAC -3'
(R):5'- CTGTGGGCCGGTACTGATTG -3'
Posted On2015-04-17