Mutagenetix > Incidental Mutations

Incidental Mutation 'R3930:Mpo'

308433

Institutional Source

Beutler Lab

Gene Symbol

Mpo

Ensembl Gene

ENSMUSG00000009350

Gene Name

myeloperoxidase

Synonyms

MMRRC Submission

040917-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3930 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87793581-87804413 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87801040 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 433 (Y433C)

Ref Sequence

ENSEMBL: ENSMUSP00000112837 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020779] [ENSMUST00000107930] [ENSMUST00000121303] [ENSMUST00000143021] [ENSMUST00000146650]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020779
AA Change: Y433C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020779
Gene: ENSMUSG00000009350
AA Change: Y433C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:An_peroxidase	147	692	4.2e-183	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107930

SMART Domains

Protein: ENSMUSP00000103563
Gene: ENSMUSG00000009350

Domain	Start	End	E-Value	Type
SCOP:g1cxp.1	82	99	1e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121303
AA Change: Y433C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112837
Gene: ENSMUSG00000009350
AA Change: Y433C

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:An_peroxidase	147	692	4.2e-183	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130442

Predicted Effect

probably benign
Transcript: ENSMUST00000143021

SMART Domains

Protein: ENSMUSP00000123371
Gene: ENSMUSG00000009350

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
PDB:4C1M\|B	139	167	4e-11	PDB
SCOP:g1cxp.1	141	167	4e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146650

SMART Domains

Protein: ENSMUSP00000128484
Gene: ENSMUSG00000009350

Domain	Start	End	E-Value	Type
Pfam:An_peroxidase	1	112	2.4e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167903

Meta Mutation Damage Score

0.9041

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.1%
20x: 94.2%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myeloperoxidase (MPO) is a heme protein synthesized during myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. Produced as a single chain precursor, myeloperoxidase is subsequently cleaved into a light and heavy chain. The mature myeloperoxidase is a tetramer composed of 2 light chains and 2 heavy chains. This enzyme produces hypohalous acids central to the microbicidal activity of neutrophils. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene causes neutrophil dysfunction and decreased resistance to fungal infection with Candida, and may lead to enhanced atherosclerosis, reduced neutrophil-mediated lysis of muscle cells, decreased resistance to EAE, and altered asbestos-induced lung inflammation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	G	T	10: 116,112,635	Q329K	possibly damaging	Het
Bpifb1	A	G	2: 154,215,322	N400S	possibly damaging	Het
Cep250	G	A	2: 155,992,632	R2159K	probably damaging	Het
Crhr1	T	A	11: 104,153,551	S22T	probably benign	Het
Cyp4a10	G	T	4: 115,524,783	V221L	probably benign	Het
D1Pas1	G	T	1: 186,968,280	W135C	probably damaging	Het
Dcbld2	T	C	16: 58,465,338	L620P	probably damaging	Het
Dnah17	C	T	11: 118,080,849		probably benign	Het
Dnm3	T	C	1: 162,084,130	D66G	probably damaging	Het
Fzd10	G	A	5: 128,602,412	V399M	probably damaging	Het
Gm10801	T	A	2: 98,664,016	I146N	possibly damaging	Het
Gm20767	G	A	13: 120,154,832	C69Y	probably damaging	Het
Gm436	C	T	4: 144,670,128	E345K	probably damaging	Het
Gm525	T	A	11: 89,075,004		probably null	Het
Gpr37l1	T	C	1: 135,161,362	I322V	probably benign	Het
Grid2ip	T	G	5: 143,386,039	S679R	probably damaging	Het
Gyg	A	T	3: 20,155,025	S15T	probably benign	Het
Hace1	G	A	10: 45,711,508	C901Y	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hp1bp3	C	T	4: 138,221,707	A27V	probably benign	Het
Hsf5	A	G	11: 87,631,682	Y367C	probably damaging	Het
Igf2r	T	C	17: 12,705,829	I1034V	probably benign	Het
Itpr1	A	G	6: 108,394,841	T1159A	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrrc14	T	C	15: 76,713,565	V165A	probably benign	Het
Lrrc45	C	T	11: 120,718,677	A422V	probably benign	Het
Lrrk2	T	A	15: 91,767,461		probably null	Het
Map3k4	T	C	17: 12,235,993	H1370R	possibly damaging	Het
Nfkbil1	G	T	17: 35,220,956	Q194K	probably benign	Het
Nin	C	T	12: 70,078,242	G102E	probably damaging	Het
Nmt1	T	C	11: 103,052,233	V138A	probably benign	Het
Olfr1215	A	G	2: 89,002,033	F85S	probably benign	Het
Olfr430	T	A	1: 174,069,581	F94L	probably damaging	Het
Olfr432	A	T	1: 174,050,510	I46F	probably damaging	Het
Olfr629	A	C	7: 103,740,587	Y218D	probably damaging	Het
Optc	T	A	1: 133,901,182	R176*	probably null	Het
Oxct1	T	A	15: 4,037,119	N72K	possibly damaging	Het
Plxna2	G	A	1: 194,794,910	A1243T	probably benign	Het
Rin1	G	T	19: 5,052,974	L430F	probably benign	Het
Ros1	A	T	10: 52,194,848	S37T	possibly damaging	Het
Rrp36	G	T	17: 46,672,806	Q27K	probably damaging	Het
Sez6	T	C	11: 77,976,882	I875T	probably damaging	Het
Sfrp5	T	G	19: 42,201,818	Y65S	probably damaging	Het
Slc25a54	T	A	3: 109,116,504	L472I	probably benign	Het
Slc35d3	T	C	10: 19,848,859	E417G	probably damaging	Het
Sumf2	A	G	5: 129,849,979	D52G	probably benign	Het
Sympk	A	G	7: 19,047,522	N801S	possibly damaging	Het
Tmem38b	T	C	4: 53,854,398	F210S	probably damaging	Het
Tnks	T	A	8: 34,940,812	H254L	probably damaging	Het
Trappc10	A	T	10: 78,210,403	V451E	probably benign	Het
Trim43a	A	T	9: 88,583,078	I153F	probably benign	Het
Tulp1	T	C	17: 28,353,709	N213S	probably damaging	Het
Ubr1	T	C	2: 120,916,470	D830G	probably benign	Het
Uqcc3	C	T	19: 8,880,705		probably null	Het
Vmn2r26	T	A	6: 124,025,979	M116K	probably benign	Het
Zscan12	A	G	13: 21,368,630	Q208R	probably benign	Het

Other mutations in Mpo

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Mpo	APN	11	87802617	missense	probably benign
IGL00668:Mpo	APN	11	87797334	missense	probably benign	0.01
IGL01016:Mpo	APN	11	87797610	splice site	probably null
IGL01517:Mpo	APN	11	87795821	missense	possibly damaging	0.83
IGL01530:Mpo	APN	11	87801191	missense	probably benign	0.00
IGL02123:Mpo	APN	11	87794795	missense	probably benign	0.05
BB001:Mpo	UTSW	11	87794840	missense	probably damaging	1.00
BB011:Mpo	UTSW	11	87794840	missense	probably damaging	1.00
R0091:Mpo	UTSW	11	87801610	missense	probably benign	0.06
R0458:Mpo	UTSW	11	87796297	missense	probably benign	0.35
R0506:Mpo	UTSW	11	87803504	missense	probably benign	0.00
R0574:Mpo	UTSW	11	87796076	missense	probably damaging	0.99
R0850:Mpo	UTSW	11	87797502	missense	probably damaging	1.00
R1488:Mpo	UTSW	11	87797430	missense	probably damaging	1.00
R1753:Mpo	UTSW	11	87795881	missense	probably benign	0.06
R1785:Mpo	UTSW	11	87797361	missense	possibly damaging	0.90
R1891:Mpo	UTSW	11	87801280	nonsense	probably null
R1989:Mpo	UTSW	11	87803472	missense	probably damaging	1.00
R2107:Mpo	UTSW	11	87796075	missense	probably damaging	1.00
R2108:Mpo	UTSW	11	87796075	missense	probably damaging	1.00
R2130:Mpo	UTSW	11	87797361	missense	possibly damaging	0.90
R2132:Mpo	UTSW	11	87797361	missense	possibly damaging	0.90
R3931:Mpo	UTSW	11	87801040	missense	probably damaging	1.00
R3941:Mpo	UTSW	11	87797349	missense	probably benign	0.02
R4323:Mpo	UTSW	11	87796039	missense	probably damaging	1.00
R4857:Mpo	UTSW	11	87796281	missense	probably benign
R4892:Mpo	UTSW	11	87802681	missense	probably benign	0.00
R5224:Mpo	UTSW	11	87796457	unclassified	probably benign
R5250:Mpo	UTSW	11	87803433	missense	probably benign	0.03
R5373:Mpo	UTSW	11	87803611	critical splice donor site	probably null
R5374:Mpo	UTSW	11	87803611	critical splice donor site	probably null
R5408:Mpo	UTSW	11	87801025	splice site	probably null
R5708:Mpo	UTSW	11	87801755	splice site	probably null
R6354:Mpo	UTSW	11	87797346	missense	possibly damaging	0.89
R6598:Mpo	UTSW	11	87799972	missense	probably benign	0.43
R6713:Mpo	UTSW	11	87795368	missense	probably damaging	1.00
R7053:Mpo	UTSW	11	87803510	missense	probably damaging	0.99
R7395:Mpo	UTSW	11	87801124	missense	probably damaging	1.00
R7573:Mpo	UTSW	11	87797577	missense	probably benign	0.01
R7924:Mpo	UTSW	11	87794840	missense	probably damaging	1.00
R8152:Mpo	UTSW	11	87801649	missense	probably benign
R8285:Mpo	UTSW	11	87797567	missense	probably benign	0.05
R8776:Mpo	UTSW	11	87802712	missense	possibly damaging	0.50
R8776-TAIL:Mpo	UTSW	11	87802712	missense	possibly damaging	0.50
R8807:Mpo	UTSW	11	87796339	missense	probably benign	0.05
RF018:Mpo	UTSW	11	87797639	missense	probably damaging	1.00
Z1088:Mpo	UTSW	11	87795245	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CACTAATACCTTAAAGACACGGGG -3'
(R):5'- AAGACCTTGCTGAGTGGGAC -3'

Sequencing Primer
(F):5'- TACCTTAAAGACACGGGGGATATTAC -3'
(R):5'- CTGTGGGCCGGTACTGATTG -3'

Posted On

2015-04-17