Incidental Mutation 'R3930:Crhr1'
ID308436
Institutional Source Beutler Lab
Gene Symbol Crhr1
Ensembl Gene ENSMUSG00000018634
Gene Namecorticotropin releasing hormone receptor 1
SynonymsCRF 1 receptor, CRFR1, CRF-R1alpha
MMRRC Submission 040917-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R3930 (G1)
Quality Score190
Status Validated
Chromosome11
Chromosomal Location104132855-104175523 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104153551 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 22 (S22T)
Ref Sequence ENSEMBL: ENSMUSP00000091455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093925]
Predicted Effect probably benign
Transcript: ENSMUST00000093925
AA Change: S22T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000091455
Gene: ENSMUSG00000018634
AA Change: S22T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
HormR 40 111 5.59e-26 SMART
Pfam:7tm_2 116 359 7.2e-81 PFAM
Meta Mutation Damage Score 0.2810 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: The protein encoded by this gene is a G-protein coupled receptor that binds corticotropin-releasing factor (CRH) and urocortin (UCN) with high affinity. The encoded protein upregulates adenylate cyclase activity and intracellular cAMP levels. This protein is essential for the activation of signal transduction pathways that regulate diverse physiological processes including stress, reproduction, immune response, and obesity. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit agenesis of the adrenal zona fasciculata, low adrenocorticotropic hormone production, and reduced anxiety-related behaviors. Progeny of homozygote matings die from lung dysplasia within 48 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik G T 10: 116,112,635 Q329K possibly damaging Het
Bpifb1 A G 2: 154,215,322 N400S possibly damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cyp4a10 G T 4: 115,524,783 V221L probably benign Het
D1Pas1 G T 1: 186,968,280 W135C probably damaging Het
Dcbld2 T C 16: 58,465,338 L620P probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnm3 T C 1: 162,084,130 D66G probably damaging Het
Fzd10 G A 5: 128,602,412 V399M probably damaging Het
Gm10801 T A 2: 98,664,016 I146N possibly damaging Het
Gm20767 G A 13: 120,154,832 C69Y probably damaging Het
Gm436 C T 4: 144,670,128 E345K probably damaging Het
Gm525 T A 11: 89,075,004 probably null Het
Gpr37l1 T C 1: 135,161,362 I322V probably benign Het
Grid2ip T G 5: 143,386,039 S679R probably damaging Het
Gyg A T 3: 20,155,025 S15T probably benign Het
Hace1 G A 10: 45,711,508 C901Y probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hp1bp3 C T 4: 138,221,707 A27V probably benign Het
Hsf5 A G 11: 87,631,682 Y367C probably damaging Het
Igf2r T C 17: 12,705,829 I1034V probably benign Het
Itpr1 A G 6: 108,394,841 T1159A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc14 T C 15: 76,713,565 V165A probably benign Het
Lrrc45 C T 11: 120,718,677 A422V probably benign Het
Lrrk2 T A 15: 91,767,461 probably null Het
Map3k4 T C 17: 12,235,993 H1370R possibly damaging Het
Mpo A G 11: 87,801,040 Y433C probably damaging Het
Nfkbil1 G T 17: 35,220,956 Q194K probably benign Het
Nin C T 12: 70,078,242 G102E probably damaging Het
Nmt1 T C 11: 103,052,233 V138A probably benign Het
Olfr1215 A G 2: 89,002,033 F85S probably benign Het
Olfr430 T A 1: 174,069,581 F94L probably damaging Het
Olfr432 A T 1: 174,050,510 I46F probably damaging Het
Olfr629 A C 7: 103,740,587 Y218D probably damaging Het
Optc T A 1: 133,901,182 R176* probably null Het
Oxct1 T A 15: 4,037,119 N72K possibly damaging Het
Plxna2 G A 1: 194,794,910 A1243T probably benign Het
Rin1 G T 19: 5,052,974 L430F probably benign Het
Ros1 A T 10: 52,194,848 S37T possibly damaging Het
Rrp36 G T 17: 46,672,806 Q27K probably damaging Het
Sez6 T C 11: 77,976,882 I875T probably damaging Het
Sfrp5 T G 19: 42,201,818 Y65S probably damaging Het
Slc25a54 T A 3: 109,116,504 L472I probably benign Het
Slc35d3 T C 10: 19,848,859 E417G probably damaging Het
Sumf2 A G 5: 129,849,979 D52G probably benign Het
Sympk A G 7: 19,047,522 N801S possibly damaging Het
Tmem38b T C 4: 53,854,398 F210S probably damaging Het
Tnks T A 8: 34,940,812 H254L probably damaging Het
Trappc10 A T 10: 78,210,403 V451E probably benign Het
Trim43a A T 9: 88,583,078 I153F probably benign Het
Tulp1 T C 17: 28,353,709 N213S probably damaging Het
Ubr1 T C 2: 120,916,470 D830G probably benign Het
Uqcc3 C T 19: 8,880,705 probably null Het
Vmn2r26 T A 6: 124,025,979 M116K probably benign Het
Zscan12 A G 13: 21,368,630 Q208R probably benign Het
Other mutations in Crhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02156:Crhr1 APN 11 104163883 missense probably benign
R0764:Crhr1 UTSW 11 104159326 missense probably damaging 0.99
R1386:Crhr1 UTSW 11 104174394 missense possibly damaging 0.86
R1812:Crhr1 UTSW 11 104169147 missense probably damaging 1.00
R1822:Crhr1 UTSW 11 104133072 start codon destroyed probably benign
R1903:Crhr1 UTSW 11 104169849 missense probably damaging 1.00
R3427:Crhr1 UTSW 11 104173593 critical splice acceptor site probably null
R5285:Crhr1 UTSW 11 104170497 missense possibly damaging 0.94
R5537:Crhr1 UTSW 11 104163856 missense possibly damaging 0.94
R6243:Crhr1 UTSW 11 104173914 missense probably damaging 1.00
R6273:Crhr1 UTSW 11 104163856 missense possibly damaging 0.94
R7372:Crhr1 UTSW 11 104163893 splice site probably null
R7664:Crhr1 UTSW 11 104169142 missense probably benign 0.01
X0021:Crhr1 UTSW 11 104169868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACCGGGCAATTTCAAACATTC -3'
(R):5'- GGTGAGCATGTGACACATCG -3'

Sequencing Primer
(F):5'- TTTCAAACATTCAGGAGGGCAC -3'
(R):5'- GCCAAGGCTGCTTGCTAAC -3'
Posted On2015-04-17