Mutagenetix > Incidental Mutation

Incidental Mutation 'R3930:Nin'

308439

Institutional Source

Beutler Lab

Gene Symbol

Nin

Ensembl Gene

ENSMUSG00000021068

Gene Name

ninein

Synonyms

3110068G20Rik

MMRRC Submission

040917-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3930 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70011435-70113717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70078242 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 102 (G102E)

Ref Sequence

ENSEMBL: ENSMUSP00000152350 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000221275] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]

AlphaFold

Q61043

Predicted Effect

probably damaging
Transcript: ENSMUST00000021468
AA Change: G102E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: G102E

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000085314
AA Change: G102E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: G102E

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	4.15e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	4.15e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1971	2045	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000095666
AA Change: G102E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: G102E

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169074
AA Change: G102E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: G102E

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000220689
AA Change: G102E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221141

Predicted Effect

probably damaging
Transcript: ENSMUST00000221275
AA Change: G102E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221486

Predicted Effect

probably damaging
Transcript: ENSMUST00000222237
AA Change: G102E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222466

Predicted Effect

probably damaging
Transcript: ENSMUST00000222835
AA Change: G102E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000223257
AA Change: G102E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.3394

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.1%
20x: 94.2%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	G	T	10: 116,112,635	Q329K	possibly damaging	Het
Bpifb1	A	G	2: 154,215,322	N400S	possibly damaging	Het
Cep250	G	A	2: 155,992,632	R2159K	probably damaging	Het
Crhr1	T	A	11: 104,153,551	S22T	probably benign	Het
Cyp4a10	G	T	4: 115,524,783	V221L	probably benign	Het
D1Pas1	G	T	1: 186,968,280	W135C	probably damaging	Het
Dcbld2	T	C	16: 58,465,338	L620P	probably damaging	Het
Dnah17	C	T	11: 118,080,849		probably benign	Het
Dnm3	T	C	1: 162,084,130	D66G	probably damaging	Het
Fzd10	G	A	5: 128,602,412	V399M	probably damaging	Het
Gm10801	T	A	2: 98,664,016	I146N	possibly damaging	Het
Gm20767	G	A	13: 120,154,832	C69Y	probably damaging	Het
Gm436	C	T	4: 144,670,128	E345K	probably damaging	Het
Gm525	T	A	11: 89,075,004		probably null	Het
Gpr37l1	T	C	1: 135,161,362	I322V	probably benign	Het
Grid2ip	T	G	5: 143,386,039	S679R	probably damaging	Het
Gyg	A	T	3: 20,155,025	S15T	probably benign	Het
Hace1	G	A	10: 45,711,508	C901Y	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hp1bp3	C	T	4: 138,221,707	A27V	probably benign	Het
Hsf5	A	G	11: 87,631,682	Y367C	probably damaging	Het
Igf2r	T	C	17: 12,705,829	I1034V	probably benign	Het
Itpr1	A	G	6: 108,394,841	T1159A	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lrrc14	T	C	15: 76,713,565	V165A	probably benign	Het
Lrrc45	C	T	11: 120,718,677	A422V	probably benign	Het
Lrrk2	T	A	15: 91,767,461		probably null	Het
Map3k4	T	C	17: 12,235,993	H1370R	possibly damaging	Het
Mpo	A	G	11: 87,801,040	Y433C	probably damaging	Het
Nfkbil1	G	T	17: 35,220,956	Q194K	probably benign	Het
Nmt1	T	C	11: 103,052,233	V138A	probably benign	Het
Olfr1215	A	G	2: 89,002,033	F85S	probably benign	Het
Olfr430	T	A	1: 174,069,581	F94L	probably damaging	Het
Olfr432	A	T	1: 174,050,510	I46F	probably damaging	Het
Olfr629	A	C	7: 103,740,587	Y218D	probably damaging	Het
Optc	T	A	1: 133,901,182	R176*	probably null	Het
Oxct1	T	A	15: 4,037,119	N72K	possibly damaging	Het
Plxna2	G	A	1: 194,794,910	A1243T	probably benign	Het
Rin1	G	T	19: 5,052,974	L430F	probably benign	Het
Ros1	A	T	10: 52,194,848	S37T	possibly damaging	Het
Rrp36	G	T	17: 46,672,806	Q27K	probably damaging	Het
Sez6	T	C	11: 77,976,882	I875T	probably damaging	Het
Sfrp5	T	G	19: 42,201,818	Y65S	probably damaging	Het
Slc25a54	T	A	3: 109,116,504	L472I	probably benign	Het
Slc35d3	T	C	10: 19,848,859	E417G	probably damaging	Het
Sumf2	A	G	5: 129,849,979	D52G	probably benign	Het
Sympk	A	G	7: 19,047,522	N801S	possibly damaging	Het
Tmem38b	T	C	4: 53,854,398	F210S	probably damaging	Het
Tnks	T	A	8: 34,940,812	H254L	probably damaging	Het
Trappc10	A	T	10: 78,210,403	V451E	probably benign	Het
Trim43a	A	T	9: 88,583,078	I153F	probably benign	Het
Tulp1	T	C	17: 28,353,709	N213S	probably damaging	Het
Ubr1	T	C	2: 120,916,470	D830G	probably benign	Het
Uqcc3	C	T	19: 8,880,705		probably null	Het
Vmn2r26	T	A	6: 124,025,979	M116K	probably benign	Het
Zscan12	A	G	13: 21,368,630	Q208R	probably benign	Het

Other mutations in Nin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Nin	APN	12	70030088	missense	probably damaging	0.98
IGL00677:Nin	APN	12	70026860	missense	probably damaging	1.00
IGL00823:Nin	APN	12	70014793	missense	probably benign	0.01
IGL01103:Nin	APN	12	70056758	missense	probably damaging	0.99
IGL01113:Nin	APN	12	70031779	missense	probably damaging	1.00
IGL01420:Nin	APN	12	70045414	missense	probably benign	0.08
IGL01556:Nin	APN	12	70043188	missense	probably benign	0.01
IGL01663:Nin	APN	12	70043665	missense	possibly damaging	0.72
IGL02002:Nin	APN	12	70062699	nonsense	probably null
IGL02030:Nin	APN	12	70045268	missense	probably damaging	1.00
IGL02202:Nin	APN	12	70055436	missense	probably damaging	1.00
IGL02207:Nin	APN	12	70056657	missense	probably damaging	0.99
IGL02257:Nin	APN	12	70102691	missense	possibly damaging	0.71
IGL02394:Nin	APN	12	70044031	missense	probably damaging	1.00
IGL02531:Nin	APN	12	70020932	missense	probably benign	0.02
IGL03028:Nin	APN	12	70035270	missense	probably benign	0.13
IGL03155:Nin	APN	12	70031770	missense	probably damaging	1.00
IGL03197:Nin	APN	12	70026810	missense	probably benign	0.03
IGL02835:Nin	UTSW	12	70056738	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0132:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0734:Nin	UTSW	12	70030113	missense	probably benign	0.01
R0947:Nin	UTSW	12	70061186	missense	probably damaging	1.00
R1085:Nin	UTSW	12	70020962	missense	possibly damaging	0.91
R1367:Nin	UTSW	12	70043929	missense	probably damaging	0.99
R1452:Nin	UTSW	12	70017650	nonsense	probably null
R1477:Nin	UTSW	12	70044184	missense	possibly damaging	0.87
R1518:Nin	UTSW	12	70014773	missense	probably benign	0.27
R1566:Nin	UTSW	12	70054479	missense	probably damaging	0.99
R1572:Nin	UTSW	12	70038750	missense	probably damaging	1.00
R1583:Nin	UTSW	12	70031738	missense	probably benign
R1584:Nin	UTSW	12	70042669	missense	probably benign	0.03
R1699:Nin	UTSW	12	70030938	missense	probably benign	0.40
R1699:Nin	UTSW	12	70045563	missense	possibly damaging	0.87
R1765:Nin	UTSW	12	70042891	missense	probably damaging	1.00
R1794:Nin	UTSW	12	70043795	nonsense	probably null
R1952:Nin	UTSW	12	70030926	missense	probably damaging	1.00
R2004:Nin	UTSW	12	70025477	missense	probably benign	0.01
R2025:Nin	UTSW	12	70030008	missense	probably damaging	1.00
R2060:Nin	UTSW	12	70042418	missense	possibly damaging	0.64
R2213:Nin	UTSW	12	70045354	missense	probably damaging	1.00
R2224:Nin	UTSW	12	70061230	missense	probably damaging	1.00
R2247:Nin	UTSW	12	70054545	missense	probably damaging	1.00
R2972:Nin	UTSW	12	70062713	missense	probably damaging	1.00
R3776:Nin	UTSW	12	70038682	missense	possibly damaging	0.71
R3881:Nin	UTSW	12	70042541	missense	probably benign	0.00
R3959:Nin	UTSW	12	70050752	missense	probably damaging	1.00
R4229:Nin	UTSW	12	70051210	missense	probably damaging	0.99
R4359:Nin	UTSW	12	70014938	missense	probably benign	0.00
R4423:Nin	UTSW	12	70042978	missense	probably damaging	1.00
R4461:Nin	UTSW	12	70042585	missense	probably benign	0.37
R4639:Nin	UTSW	12	70038601	missense	probably damaging	0.97
R4791:Nin	UTSW	12	70043807	missense	possibly damaging	0.94
R4839:Nin	UTSW	12	70090551	missense	possibly damaging	0.46
R4912:Nin	UTSW	12	70044063	missense	probably damaging	1.00
R5712:Nin	UTSW	12	70042769	missense	probably damaging	1.00
R5726:Nin	UTSW	12	70078179	missense	probably damaging	1.00
R5804:Nin	UTSW	12	70045601	missense	possibly damaging	0.58
R5874:Nin	UTSW	12	70030918	missense	possibly damaging	0.94
R5992:Nin	UTSW	12	70045524	missense	possibly damaging	0.83
R6077:Nin	UTSW	12	70019232	missense	probably damaging	1.00
R6184:Nin	UTSW	12	70043737	missense	probably damaging	1.00
R6307:Nin	UTSW	12	70014857	missense	possibly damaging	0.91
R6315:Nin	UTSW	12	70045615	missense	probably damaging	1.00
R6326:Nin	UTSW	12	70045181	missense	possibly damaging	0.95
R6492:Nin	UTSW	12	70054534	missense	probably benign	0.22
R6562:Nin	UTSW	12	70055954	missense	probably damaging	1.00
R6578:Nin	UTSW	12	70061194	missense	probably damaging	0.99
R6613:Nin	UTSW	12	70030954	missense	probably damaging	1.00
R7112:Nin	UTSW	12	70102799	missense
R7170:Nin	UTSW	12	70044239	missense
R7324:Nin	UTSW	12	70043734	missense
R7338:Nin	UTSW	12	70044064	missense
R7372:Nin	UTSW	12	70056029	missense
R7431:Nin	UTSW	12	70078223	missense
R7577:Nin	UTSW	12	70062706	missense
R7655:Nin	UTSW	12	70042768	missense
R7656:Nin	UTSW	12	70042768	missense
R7683:Nin	UTSW	12	70078182	missense
R7769:Nin	UTSW	12	70043230	missense
R7981:Nin	UTSW	12	70042817	missense
R8138:Nin	UTSW	12	70042898	missense
R8141:Nin	UTSW	12	70030021	missense
R8754:Nin	UTSW	12	70031013	intron	probably benign
R8790:Nin	UTSW	12	70021019	missense
R8899:Nin	UTSW	12	70030936	missense	probably damaging	1.00
R8974:Nin	UTSW	12	70078158	missense
R9085:Nin	UTSW	12	70030012	nonsense	probably null
R9143:Nin	UTSW	12	70090575	missense
R9380:Nin	UTSW	12	70028031	missense
R9496:Nin	UTSW	12	70055988	missense
R9638:Nin	UTSW	12	70020844	missense
R9709:Nin	UTSW	12	70102694	missense
R9745:Nin	UTSW	12	70043125	missense
R9792:Nin	UTSW	12	70047235	missense
Z1176:Nin	UTSW	12	70049164	critical splice acceptor site	probably null
Z1177:Nin	UTSW	12	70044095	missense
Z1177:Nin	UTSW	12	70054426	missense

Predicted Primers

PCR Primer
(F):5'- TGTGTCTCATGCTACCCAGG -3'
(R):5'- ACCCAAGGACTCATATGCGC -3'

Sequencing Primer
(F):5'- TCAATGACTGAGCCTGTGAC -3'
(R):5'- AGGACTCATATGCGCCCACG -3'

Posted On

2015-04-17