Incidental Mutation 'R3930:Gm20767'
ID308441
Institutional Source Beutler Lab
Gene Symbol Gm20767
Ensembl Gene ENSMUSG00000096323
Gene Namepredicted gene, 20767
Synonyms
MMRRC Submission 040917-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R3930 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location120140246-120155335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120154832 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 69 (C69Y)
Ref Sequence ENSEMBL: ENSMUSP00000152988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179071] [ENSMUST00000225683]
Predicted Effect probably damaging
Transcript: ENSMUST00000179071
AA Change: C69Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137504
Gene: ENSMUSG00000096323
AA Change: C69Y

DomainStartEndE-ValueType
Pfam:DUF1438 7 155 3.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000225683
AA Change: C69Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik G T 10: 116,112,635 Q329K possibly damaging Het
Bpifb1 A G 2: 154,215,322 N400S possibly damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Crhr1 T A 11: 104,153,551 S22T probably benign Het
Cyp4a10 G T 4: 115,524,783 V221L probably benign Het
D1Pas1 G T 1: 186,968,280 W135C probably damaging Het
Dcbld2 T C 16: 58,465,338 L620P probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnm3 T C 1: 162,084,130 D66G probably damaging Het
Fzd10 G A 5: 128,602,412 V399M probably damaging Het
Gm10801 T A 2: 98,664,016 I146N possibly damaging Het
Gm436 C T 4: 144,670,128 E345K probably damaging Het
Gm525 T A 11: 89,075,004 probably null Het
Gpr37l1 T C 1: 135,161,362 I322V probably benign Het
Grid2ip T G 5: 143,386,039 S679R probably damaging Het
Gyg A T 3: 20,155,025 S15T probably benign Het
Hace1 G A 10: 45,711,508 C901Y probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hp1bp3 C T 4: 138,221,707 A27V probably benign Het
Hsf5 A G 11: 87,631,682 Y367C probably damaging Het
Igf2r T C 17: 12,705,829 I1034V probably benign Het
Itpr1 A G 6: 108,394,841 T1159A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc14 T C 15: 76,713,565 V165A probably benign Het
Lrrc45 C T 11: 120,718,677 A422V probably benign Het
Lrrk2 T A 15: 91,767,461 probably null Het
Map3k4 T C 17: 12,235,993 H1370R possibly damaging Het
Mpo A G 11: 87,801,040 Y433C probably damaging Het
Nfkbil1 G T 17: 35,220,956 Q194K probably benign Het
Nin C T 12: 70,078,242 G102E probably damaging Het
Nmt1 T C 11: 103,052,233 V138A probably benign Het
Olfr1215 A G 2: 89,002,033 F85S probably benign Het
Olfr430 T A 1: 174,069,581 F94L probably damaging Het
Olfr432 A T 1: 174,050,510 I46F probably damaging Het
Olfr629 A C 7: 103,740,587 Y218D probably damaging Het
Optc T A 1: 133,901,182 R176* probably null Het
Oxct1 T A 15: 4,037,119 N72K possibly damaging Het
Plxna2 G A 1: 194,794,910 A1243T probably benign Het
Rin1 G T 19: 5,052,974 L430F probably benign Het
Ros1 A T 10: 52,194,848 S37T possibly damaging Het
Rrp36 G T 17: 46,672,806 Q27K probably damaging Het
Sez6 T C 11: 77,976,882 I875T probably damaging Het
Sfrp5 T G 19: 42,201,818 Y65S probably damaging Het
Slc25a54 T A 3: 109,116,504 L472I probably benign Het
Slc35d3 T C 10: 19,848,859 E417G probably damaging Het
Sumf2 A G 5: 129,849,979 D52G probably benign Het
Sympk A G 7: 19,047,522 N801S possibly damaging Het
Tmem38b T C 4: 53,854,398 F210S probably damaging Het
Tnks T A 8: 34,940,812 H254L probably damaging Het
Trappc10 A T 10: 78,210,403 V451E probably benign Het
Trim43a A T 9: 88,583,078 I153F probably benign Het
Tulp1 T C 17: 28,353,709 N213S probably damaging Het
Ubr1 T C 2: 120,916,470 D830G probably benign Het
Uqcc3 C T 19: 8,880,705 probably null Het
Vmn2r26 T A 6: 124,025,979 M116K probably benign Het
Zscan12 A G 13: 21,368,630 Q208R probably benign Het
Other mutations in Gm20767
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1004:Gm20767 UTSW 13 120155022 missense probably benign 0.00
R3753:Gm20767 UTSW 13 120154631 missense possibly damaging 0.56
R4873:Gm20767 UTSW 13 120154670 missense probably damaging 0.98
R4875:Gm20767 UTSW 13 120154670 missense probably damaging 0.98
R5020:Gm20767 UTSW 13 120155116 missense possibly damaging 0.85
R5599:Gm20767 UTSW 13 120154922 missense probably damaging 0.99
R5802:Gm20767 UTSW 13 120154913 missense possibly damaging 0.93
R6469:Gm20767 UTSW 13 120154813 missense probably damaging 1.00
R6535:Gm20767 UTSW 13 120154654 missense probably damaging 0.98
R7543:Gm20767 UTSW 13 120154754 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAAGATGATGCAGTCCTTTTCCG -3'
(R):5'- ACCATCACAGGTTGCAAGATC -3'

Sequencing Primer
(F):5'- CCGGTTTTGTCAAGGATACATCAG -3'
(R):5'- AGGTTGCAAGATCCAGTCC -3'
Posted On2015-04-17