Incidental Mutation 'R3930:Lrrc14'
ID308443
Institutional Source Beutler Lab
Gene Symbol Lrrc14
Ensembl Gene ENSMUSG00000033728
Gene Nameleucine rich repeat containing 14
Synonyms
MMRRC Submission 040917-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R3930 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76710623-76717699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76713565 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 165 (V165A)
Ref Sequence ENSEMBL: ENSMUSP00000119670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036423] [ENSMUST00000036852] [ENSMUST00000049956] [ENSMUST00000127208] [ENSMUST00000136840] [ENSMUST00000137649] [ENSMUST00000142610] [ENSMUST00000155225] [ENSMUST00000155735] [ENSMUST00000230544] [ENSMUST00000230724]
Predicted Effect probably benign
Transcript: ENSMUST00000036423
AA Change: V165A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000049466
Gene: ENSMUSG00000033728
AA Change: V165A

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036852
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000049956
SMART Domains Protein: ENSMUSP00000061906
Gene: ENSMUSG00000033707

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 30 62 1.04e-2 SMART
LRR 61 80 3.18e2 SMART
LRR_TYP 81 104 2.99e-4 SMART
LRR 106 128 3.87e1 SMART
LRR_TYP 129 152 8.22e-2 SMART
LRR_TYP 153 176 5.06e-2 SMART
LRR 177 200 2.02e-1 SMART
LRRCT 212 266 2e-10 SMART
IGc2 280 360 1.02e-9 SMART
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127208
AA Change: V165A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114921
Gene: ENSMUSG00000033728
AA Change: V165A

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136840
AA Change: V165A

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119670
Gene: ENSMUSG00000033728
AA Change: V165A

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137649
AA Change: V165A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000121982
Gene: ENSMUSG00000033728
AA Change: V165A

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142506
Predicted Effect probably benign
Transcript: ENSMUST00000142610
SMART Domains Protein: ENSMUSP00000117780
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154531
Predicted Effect probably benign
Transcript: ENSMUST00000155225
Predicted Effect probably benign
Transcript: ENSMUST00000155735
AA Change: V165A

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115446
Gene: ENSMUSG00000033728
AA Change: V165A

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229360
Predicted Effect probably benign
Transcript: ENSMUST00000230544
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Meta Mutation Damage Score 0.1063 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a leucine-rich repeat-containing protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik G T 10: 116,112,635 Q329K possibly damaging Het
Bpifb1 A G 2: 154,215,322 N400S possibly damaging Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Crhr1 T A 11: 104,153,551 S22T probably benign Het
Cyp4a10 G T 4: 115,524,783 V221L probably benign Het
D1Pas1 G T 1: 186,968,280 W135C probably damaging Het
Dcbld2 T C 16: 58,465,338 L620P probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnm3 T C 1: 162,084,130 D66G probably damaging Het
Fzd10 G A 5: 128,602,412 V399M probably damaging Het
Gm10801 T A 2: 98,664,016 I146N possibly damaging Het
Gm20767 G A 13: 120,154,832 C69Y probably damaging Het
Gm436 C T 4: 144,670,128 E345K probably damaging Het
Gm525 T A 11: 89,075,004 probably null Het
Gpr37l1 T C 1: 135,161,362 I322V probably benign Het
Grid2ip T G 5: 143,386,039 S679R probably damaging Het
Gyg A T 3: 20,155,025 S15T probably benign Het
Hace1 G A 10: 45,711,508 C901Y probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hp1bp3 C T 4: 138,221,707 A27V probably benign Het
Hsf5 A G 11: 87,631,682 Y367C probably damaging Het
Igf2r T C 17: 12,705,829 I1034V probably benign Het
Itpr1 A G 6: 108,394,841 T1159A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc45 C T 11: 120,718,677 A422V probably benign Het
Lrrk2 T A 15: 91,767,461 probably null Het
Map3k4 T C 17: 12,235,993 H1370R possibly damaging Het
Mpo A G 11: 87,801,040 Y433C probably damaging Het
Nfkbil1 G T 17: 35,220,956 Q194K probably benign Het
Nin C T 12: 70,078,242 G102E probably damaging Het
Nmt1 T C 11: 103,052,233 V138A probably benign Het
Olfr1215 A G 2: 89,002,033 F85S probably benign Het
Olfr430 T A 1: 174,069,581 F94L probably damaging Het
Olfr432 A T 1: 174,050,510 I46F probably damaging Het
Olfr629 A C 7: 103,740,587 Y218D probably damaging Het
Optc T A 1: 133,901,182 R176* probably null Het
Oxct1 T A 15: 4,037,119 N72K possibly damaging Het
Plxna2 G A 1: 194,794,910 A1243T probably benign Het
Rin1 G T 19: 5,052,974 L430F probably benign Het
Ros1 A T 10: 52,194,848 S37T possibly damaging Het
Rrp36 G T 17: 46,672,806 Q27K probably damaging Het
Sez6 T C 11: 77,976,882 I875T probably damaging Het
Sfrp5 T G 19: 42,201,818 Y65S probably damaging Het
Slc25a54 T A 3: 109,116,504 L472I probably benign Het
Slc35d3 T C 10: 19,848,859 E417G probably damaging Het
Sumf2 A G 5: 129,849,979 D52G probably benign Het
Sympk A G 7: 19,047,522 N801S possibly damaging Het
Tmem38b T C 4: 53,854,398 F210S probably damaging Het
Tnks T A 8: 34,940,812 H254L probably damaging Het
Trappc10 A T 10: 78,210,403 V451E probably benign Het
Trim43a A T 9: 88,583,078 I153F probably benign Het
Tulp1 T C 17: 28,353,709 N213S probably damaging Het
Ubr1 T C 2: 120,916,470 D830G probably benign Het
Uqcc3 C T 19: 8,880,705 probably null Het
Vmn2r26 T A 6: 124,025,979 M116K probably benign Het
Zscan12 A G 13: 21,368,630 Q208R probably benign Het
Other mutations in Lrrc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Lrrc14 APN 15 76713742 missense probably damaging 0.99
IGL03213:Lrrc14 APN 15 76713783 missense possibly damaging 0.95
Sojourn UTSW 15 76713446 missense possibly damaging 0.91
Sumo UTSW 15 76713565 missense probably benign 0.17
R0302:Lrrc14 UTSW 15 76714352 missense probably benign 0.28
R2417:Lrrc14 UTSW 15 76713421 missense probably damaging 1.00
R3423:Lrrc14 UTSW 15 76713118 unclassified probably null
R3931:Lrrc14 UTSW 15 76713565 missense probably benign 0.17
R4622:Lrrc14 UTSW 15 76716340 unclassified probably benign
R4863:Lrrc14 UTSW 15 76713362 unclassified probably null
R5290:Lrrc14 UTSW 15 76713943 missense probably benign 0.17
R5451:Lrrc14 UTSW 15 76713973 missense probably benign 0.01
R5950:Lrrc14 UTSW 15 76715310 unclassified probably benign
R6561:Lrrc14 UTSW 15 76713446 missense possibly damaging 0.91
R6609:Lrrc14 UTSW 15 76714253 missense probably benign
R7341:Lrrc14 UTSW 15 76714511 missense probably damaging 1.00
R7638:Lrrc14 UTSW 15 76713973 missense probably benign 0.01
R8046:Lrrc14 UTSW 15 76714531 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TCTGTACAAAGTAGCTGGGAGG -3'
(R):5'- ACAGCCTGCATCTAAAAGCTG -3'

Sequencing Primer
(F):5'- AGGGATGCTGGCCTTTCTCC -3'
(R):5'- CCTGCATCTAAAAGCTGTAGCAGG -3'
Posted On2015-04-17