Mutagenetix > Incidental Mutation

Incidental Mutation 'R3931:Kirrel1'

308460

Institutional Source

Beutler Lab

Gene Symbol

Kirrel1

Ensembl Gene

ENSMUSG00000041734

Gene Name

kirre like nephrin family adhesion molecule 1

Synonyms

6720469N11Rik, Neph1, Kirrel1, Kirrel

MMRRC Submission

040918-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3931 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86985900-87082054 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86996458 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 380 (M380I)

Ref Sequence

ENSEMBL: ENSMUSP00000125525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]

AlphaFold

Q80W68

Predicted Effect

probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Meta Mutation Damage Score

0.0922

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.3%
20x: 94.8%

Validation Efficiency

100% (30/30)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]

Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730049H05Rik	A	C	6: 92,811,420 (GRCm39)		probably benign	Het
Cbarp	A	G	10: 79,971,348 (GRCm39)	L159P	probably damaging	Het
Ccnd2	A	G	6: 127,107,422 (GRCm39)	I249T	probably damaging	Het
Cerk	G	T	15: 86,039,311 (GRCm39)	C193*	probably null	Het
Chrna2	A	G	14: 66,387,216 (GRCm39)	E454G	probably benign	Het
Clnk	T	C	5: 38,925,412 (GRCm39)	T130A	probably benign	Het
Dcbld2	T	C	16: 58,285,701 (GRCm39)	L620P	probably damaging	Het
Dhx29	T	A	13: 113,095,499 (GRCm39)	V942E	probably damaging	Het
Dnah17	C	T	11: 117,971,675 (GRCm39)		probably benign	Het
Dnai1	G	A	4: 41,604,229 (GRCm39)	C212Y	probably damaging	Het
Dpep1	A	G	8: 123,925,518 (GRCm39)	D57G	possibly damaging	Het
Gfm2	G	A	13: 97,311,532 (GRCm39)	V701I	probably benign	Het
Grm1	C	T	10: 10,595,622 (GRCm39)	A669T	probably benign	Het
Hsd3b3	C	T	3: 98,649,492 (GRCm39)	G277D	probably damaging	Het
Hsf5	A	G	11: 87,522,508 (GRCm39)	Y367C	probably damaging	Het
Lipo4	C	T	19: 33,480,619 (GRCm39)	V250I	probably benign	Het
Lrrc14	T	C	15: 76,597,765 (GRCm39)	V165A	probably benign	Het
Map3k9	A	G	12: 81,819,691 (GRCm39)	F188L	probably damaging	Het
Mpo	A	G	11: 87,691,866 (GRCm39)	Y433C	probably damaging	Het
Nsd2	A	G	5: 34,003,461 (GRCm39)	K185E	probably benign	Het
Or6n2	T	A	1: 173,897,147 (GRCm39)	F94L	probably damaging	Het
Oxct1	T	A	15: 4,066,601 (GRCm39)	N72K	possibly damaging	Het
Ptpn12	A	G	5: 21,206,321 (GRCm39)	I324T	probably benign	Het
Sez6	T	C	11: 77,867,708 (GRCm39)	I875T	probably damaging	Het
Tpr	T	A	1: 150,311,655 (GRCm39)	V1811E	probably damaging	Het
Trpc4	A	G	3: 54,225,516 (GRCm39)	D871G	probably damaging	Het
Upf2	A	G	2: 6,051,821 (GRCm39)	E1161G	unknown	Het
Zp2	T	C	7: 119,731,580 (GRCm39)		probably benign	Het

Other mutations in Kirrel1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Kirrel1	APN	3	86,997,182 (GRCm39)	missense	probably benign	0.22
IGL01865:Kirrel1	APN	3	86,993,731 (GRCm39)	missense	probably damaging	1.00
IGL01875:Kirrel1	APN	3	87,003,037 (GRCm39)	missense	probably damaging	1.00
IGL02337:Kirrel1	APN	3	86,996,519 (GRCm39)	missense	possibly damaging	0.64
IGL02724:Kirrel1	APN	3	86,997,780 (GRCm39)	nonsense	probably null
IGL02825:Kirrel1	APN	3	86,996,595 (GRCm39)	splice site	probably benign
IGL02826:Kirrel1	APN	3	86,995,792 (GRCm39)	missense	probably damaging	1.00
IGL03102:Kirrel1	APN	3	86,990,807 (GRCm39)	missense	probably damaging	0.98
D4043:Kirrel1	UTSW	3	86,990,510 (GRCm39)	missense	probably benign	0.02
R0360:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0364:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0421:Kirrel1	UTSW	3	86,990,914 (GRCm39)	missense	probably damaging	0.99
R0503:Kirrel1	UTSW	3	87,005,109 (GRCm39)	missense	probably benign	0.20
R1112:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1116:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1144:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1190:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1226:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1501:Kirrel1	UTSW	3	86,997,779 (GRCm39)	missense	probably benign	0.02
R1538:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1546:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1628:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1630:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1631:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1664:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1671:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1695:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1769:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1807:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1808:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1840:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1995:Kirrel1	UTSW	3	87,003,093 (GRCm39)	missense	possibly damaging	0.88
R2014:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2086:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2108:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2354:Kirrel1	UTSW	3	86,995,792 (GRCm39)	missense	probably damaging	0.98
R2407:Kirrel1	UTSW	3	86,992,150 (GRCm39)	missense	probably benign	0.03
R2904:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2905:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2958:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2959:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2960:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2961:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3026:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3028:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3034:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R3149:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3195:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3196:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3499:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3699:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3720:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3721:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3788:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3793:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3877:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3901:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3910:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3911:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3912:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3913:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3930:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4022:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4067:Kirrel1	UTSW	3	86,995,774 (GRCm39)	nonsense	probably null
R4077:Kirrel1	UTSW	3	86,992,387 (GRCm39)	critical splice donor site	probably null
R4198:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4328:Kirrel1	UTSW	3	86,992,081 (GRCm39)	intron	probably benign
R4355:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4363:Kirrel1	UTSW	3	86,997,792 (GRCm39)	nonsense	probably null
R4378:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4386:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4460:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4468:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4469:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4650:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4652:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4734:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4748:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4749:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R5304:Kirrel1	UTSW	3	86,996,902 (GRCm39)	missense	probably benign	0.02
R5534:Kirrel1	UTSW	3	86,997,825 (GRCm39)	missense	probably damaging	1.00
R5604:Kirrel1	UTSW	3	86,996,462 (GRCm39)	missense	possibly damaging	0.69
R7199:Kirrel1	UTSW	3	86,990,695 (GRCm39)	missense	probably benign	0.02
R7221:Kirrel1	UTSW	3	86,993,704 (GRCm39)	nonsense	probably null
R7284:Kirrel1	UTSW	3	86,990,694 (GRCm39)	missense	probably benign	0.02
R7332:Kirrel1	UTSW	3	86,995,705 (GRCm39)	missense	probably benign	0.14
R7369:Kirrel1	UTSW	3	87,048,391 (GRCm39)	missense	probably benign	0.20
R7371:Kirrel1	UTSW	3	86,995,729 (GRCm39)	missense	probably benign	0.44
R7508:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R7566:Kirrel1	UTSW	3	86,995,791 (GRCm39)	missense	probably damaging	1.00
R7567:Kirrel1	UTSW	3	87,002,988 (GRCm39)	missense	probably damaging	0.99
R7621:Kirrel1	UTSW	3	86,995,528 (GRCm39)	missense	possibly damaging	0.70
R8030:Kirrel1	UTSW	3	87,005,082 (GRCm39)	missense	probably damaging	1.00
R8141:Kirrel1	UTSW	3	86,993,735 (GRCm39)	nonsense	probably null
R8261:Kirrel1	UTSW	3	86,995,309 (GRCm39)	intron	probably benign
R8477:Kirrel1	UTSW	3	86,992,138 (GRCm39)	missense	possibly damaging	0.71
R8512:Kirrel1	UTSW	3	86,995,534 (GRCm39)	missense	probably benign	0.00
R8954:Kirrel1	UTSW	3	86,997,173 (GRCm39)	missense	probably benign	0.25
R8987:Kirrel1	UTSW	3	86,992,400 (GRCm39)	missense	probably damaging	1.00
R9058:Kirrel1	UTSW	3	86,992,442 (GRCm39)	missense	probably benign	0.18
R9146:Kirrel1	UTSW	3	87,003,015 (GRCm39)	missense	probably damaging	1.00
R9311:Kirrel1	UTSW	3	87,005,123 (GRCm39)	missense	probably benign	0.29
R9527:Kirrel1	UTSW	3	86,996,912 (GRCm39)	nonsense	probably null
R9629:Kirrel1	UTSW	3	87,003,025 (GRCm39)	nonsense	probably null
Z1177:Kirrel1	UTSW	3	86,991,182 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCCTGAGTTCTATGCAAGTCC -3'
(R):5'- AGCTGATGATTCTCAGGCAC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- TCAGGCACCTGAGACTCTGAC -3'

Posted On

2015-04-17