Incidental Mutation 'R3931:Clnk'
ID308465
Institutional Source Beutler Lab
Gene Symbol Clnk
Ensembl Gene ENSMUSG00000039315
Gene Namecytokine-dependent hematopoietic cell linker
SynonymsMIST
MMRRC Submission 040918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3931 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location38706462-38876812 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38768069 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 130 (T130A)
Ref Sequence ENSEMBL: ENSMUSP00000132779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169819] [ENSMUST00000171633]
Predicted Effect probably benign
Transcript: ENSMUST00000169819
AA Change: T130A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128473
Gene: ENSMUSG00000039315
AA Change: T130A

DomainStartEndE-ValueType
low complexity region 158 188 N/A INTRINSIC
SH2 307 398 3.53e-19 SMART
low complexity region 414 427 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171633
AA Change: T130A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132779
Gene: ENSMUSG00000039315
AA Change: T130A

DomainStartEndE-ValueType
low complexity region 158 188 N/A INTRINSIC
SH2 307 398 3.53e-19 SMART
low complexity region 414 427 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MIST is a member of the SLP76 family of adaptors (see LCP2, MIM 601603; BLNK, MIM 604515). MIST plays a role in the regulation of immunoreceptor signaling, including PLC-gamma (PLCG1; MIM 172420)-mediated B cell antigen receptor (BCR) signaling and FC-epsilon R1 (see FCER1A, MIM 147140)-mediated mast cell degranulation (Cao et al., 1999 [PubMed 10562326]; Goitsuka et al., 2000, 2001 [PubMed 10744659] [PubMed 11463797]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a reporter allele display altered natural killer (NK) T cell physiology and enhanced NK cell cytolysis. Mice homozygous for knock-out allele display abnormal mast cell physiology as well as enhanced NK cell cytolysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik A C 6: 92,834,439 probably benign Het
Cbarp A G 10: 80,135,514 L159P probably damaging Het
Ccnd2 A G 6: 127,130,459 I249T probably damaging Het
Cerk G T 15: 86,155,110 C193* probably null Het
Chrna2 A G 14: 66,149,767 E454G probably benign Het
Dcbld2 T C 16: 58,465,338 L620P probably damaging Het
Dhx29 T A 13: 112,958,965 V942E probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnaic1 G A 4: 41,604,229 C212Y probably damaging Het
Dpep1 A G 8: 123,198,779 D57G possibly damaging Het
Gfm2 G A 13: 97,175,024 V701I probably benign Het
Grm1 C T 10: 10,719,878 A669T probably benign Het
Hsd3b3 C T 3: 98,742,176 G277D probably damaging Het
Hsf5 A G 11: 87,631,682 Y367C probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lipo4 C T 19: 33,503,219 V250I probably benign Het
Lrrc14 T C 15: 76,713,565 V165A probably benign Het
Map3k9 A G 12: 81,772,917 F188L probably damaging Het
Mpo A G 11: 87,801,040 Y433C probably damaging Het
Nsd2 A G 5: 33,846,117 K185E probably benign Het
Olfr430 T A 1: 174,069,581 F94L probably damaging Het
Oxct1 T A 15: 4,037,119 N72K possibly damaging Het
Ptpn12 A G 5: 21,001,323 I324T probably benign Het
Sez6 T C 11: 77,976,882 I875T probably damaging Het
Tpr T A 1: 150,435,904 V1811E probably damaging Het
Trpc4 A G 3: 54,318,095 D871G probably damaging Het
Upf2 A G 2: 6,047,010 E1161G unknown Het
Zp2 T C 7: 120,132,357 probably benign Het
Other mutations in Clnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Clnk APN 5 38784528 missense possibly damaging 0.95
IGL01348:Clnk APN 5 38713207 missense probably damaging 1.00
IGL01901:Clnk APN 5 38794978 missense probably damaging 1.00
IGL01908:Clnk APN 5 38713142 missense probably damaging 1.00
IGL02437:Clnk APN 5 38774566 critical splice donor site probably null
IGL02745:Clnk APN 5 38736319 missense probably benign 0.00
R0138:Clnk UTSW 5 38774608 splice site probably benign
R0196:Clnk UTSW 5 38769939 missense probably damaging 0.97
R1522:Clnk UTSW 5 38794966 missense probably damaging 1.00
R1958:Clnk UTSW 5 38706626 missense possibly damaging 0.96
R2036:Clnk UTSW 5 38752800 splice site probably null
R2238:Clnk UTSW 5 38764351 splice site probably benign
R3788:Clnk UTSW 5 38714998 missense probably damaging 1.00
R4159:Clnk UTSW 5 38741795 intron probably benign
R4182:Clnk UTSW 5 38747850 intron probably benign
R4686:Clnk UTSW 5 38741837 intron probably benign
R4751:Clnk UTSW 5 38720913 missense probably benign 0.06
R4842:Clnk UTSW 5 38713069 splice site probably null
R5811:Clnk UTSW 5 38713147 missense probably damaging 1.00
R6236:Clnk UTSW 5 38713199 missense probably benign 0.41
R7157:Clnk UTSW 5 38769891 missense possibly damaging 0.63
R7615:Clnk UTSW 5 38706698 missense probably damaging 1.00
R7618:Clnk UTSW 5 38736355 missense probably benign 0.06
R7762:Clnk UTSW 5 38768141 missense probably benign 0.24
R7768:Clnk UTSW 5 38768158 missense probably damaging 1.00
R7823:Clnk UTSW 5 38750351 missense probably benign 0.00
R8158:Clnk UTSW 5 38794911 critical splice donor site probably null
R8423:Clnk UTSW 5 38794910 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGTTCATGAGCCCATAAGTC -3'
(R):5'- AGAGATGTGTTTGCCTGGCAC -3'

Sequencing Primer
(F):5'- TGAGCCCATAAGTCACACAATTCAG -3'
(R):5'- AGCTTTGATGACCCCATGAG -3'
Posted On2015-04-17