Incidental Mutation 'R3931:Dcbld2'
ID308483
Institutional Source Beutler Lab
Gene Symbol Dcbld2
Ensembl Gene ENSMUSG00000035107
Gene Namediscoidin, CUB and LCCL domain containing 2
SynonymsEsdn, 1700055P21Rik, CLCP1
MMRRC Submission 040918-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3931 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58408443-58469727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58465338 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 620 (L620P)
Ref Sequence ENSEMBL: ENSMUSP00000039915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046663] [ENSMUST00000114357] [ENSMUST00000114358] [ENSMUST00000137035]
Predicted Effect probably damaging
Transcript: ENSMUST00000046663
AA Change: L620P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039915
Gene: ENSMUSG00000035107
AA Change: L620P

DomainStartEndE-ValueType
low complexity region 2 34 N/A INTRINSIC
CUB 69 184 4.26e-37 SMART
LCCL 188 273 4.74e-37 SMART
FA58C 288 446 4.08e-28 SMART
transmembrane domain 522 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114357
SMART Domains Protein: ENSMUSP00000109997
Gene: ENSMUSG00000022747

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 63 329 6.2e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114358
SMART Domains Protein: ENSMUSP00000109998
Gene: ENSMUSG00000022747

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 71 329 7.1e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135415
Predicted Effect probably benign
Transcript: ENSMUST00000137035
SMART Domains Protein: ENSMUSP00000115756
Gene: ENSMUSG00000022747

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 63 329 6.2e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150817
Meta Mutation Damage Score 0.6830 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced postnatal angiogenesis and impaired recovery from femoral artery ligation with impaired blood flow and decreased capillary density. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik A C 6: 92,834,439 probably benign Het
Cbarp A G 10: 80,135,514 L159P probably damaging Het
Ccnd2 A G 6: 127,130,459 I249T probably damaging Het
Cerk G T 15: 86,155,110 C193* probably null Het
Chrna2 A G 14: 66,149,767 E454G probably benign Het
Clnk T C 5: 38,768,069 T130A probably benign Het
Dhx29 T A 13: 112,958,965 V942E probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnaic1 G A 4: 41,604,229 C212Y probably damaging Het
Dpep1 A G 8: 123,198,779 D57G possibly damaging Het
Gfm2 G A 13: 97,175,024 V701I probably benign Het
Grm1 C T 10: 10,719,878 A669T probably benign Het
Hsd3b3 C T 3: 98,742,176 G277D probably damaging Het
Hsf5 A G 11: 87,631,682 Y367C probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lipo4 C T 19: 33,503,219 V250I probably benign Het
Lrrc14 T C 15: 76,713,565 V165A probably benign Het
Map3k9 A G 12: 81,772,917 F188L probably damaging Het
Mpo A G 11: 87,801,040 Y433C probably damaging Het
Nsd2 A G 5: 33,846,117 K185E probably benign Het
Olfr430 T A 1: 174,069,581 F94L probably damaging Het
Oxct1 T A 15: 4,037,119 N72K possibly damaging Het
Ptpn12 A G 5: 21,001,323 I324T probably benign Het
Sez6 T C 11: 77,976,882 I875T probably damaging Het
Tpr T A 1: 150,435,904 V1811E probably damaging Het
Trpc4 A G 3: 54,318,095 D871G probably damaging Het
Upf2 A G 2: 6,047,010 E1161G unknown Het
Zp2 T C 7: 120,132,357 probably benign Het
Other mutations in Dcbld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Dcbld2 APN 16 58408873 missense possibly damaging 0.75
IGL01978:Dcbld2 APN 16 58464319 missense probably benign 0.00
IGL02143:Dcbld2 APN 16 58448526 critical splice donor site probably null
IGL02953:Dcbld2 APN 16 58451737 missense probably benign 0.29
IGL03109:Dcbld2 APN 16 58456402 missense probably benign 0.06
IGL03131:Dcbld2 APN 16 58451688 missense probably benign 0.00
R0183:Dcbld2 UTSW 16 58445359 missense possibly damaging 0.70
R0305:Dcbld2 UTSW 16 58448939 missense probably damaging 1.00
R0316:Dcbld2 UTSW 16 58433445 missense probably damaging 1.00
R0371:Dcbld2 UTSW 16 58450823 missense probably benign 0.09
R0548:Dcbld2 UTSW 16 58455145 missense probably damaging 0.98
R0751:Dcbld2 UTSW 16 58449841 critical splice donor site probably null
R0906:Dcbld2 UTSW 16 58455247 missense probably damaging 1.00
R1184:Dcbld2 UTSW 16 58449841 critical splice donor site probably null
R1557:Dcbld2 UTSW 16 58465350 missense possibly damaging 0.49
R1995:Dcbld2 UTSW 16 58456332 missense probably benign
R3930:Dcbld2 UTSW 16 58465338 missense probably damaging 1.00
R4080:Dcbld2 UTSW 16 58465373 missense probably damaging 1.00
R4385:Dcbld2 UTSW 16 58463066 missense probably damaging 0.96
R4615:Dcbld2 UTSW 16 58456094 missense probably benign 0.03
R4739:Dcbld2 UTSW 16 58460976 missense probably damaging 1.00
R4963:Dcbld2 UTSW 16 58465782 missense probably benign
R4968:Dcbld2 UTSW 16 58424711 missense probably damaging 1.00
R5419:Dcbld2 UTSW 16 58455258 missense probably damaging 0.99
R5684:Dcbld2 UTSW 16 58449809 missense possibly damaging 0.90
R5737:Dcbld2 UTSW 16 58460985 missense probably damaging 1.00
R6277:Dcbld2 UTSW 16 58451756 missense probably damaging 0.97
R6277:Dcbld2 UTSW 16 58465503 missense probably damaging 1.00
R6468:Dcbld2 UTSW 16 58433373 nonsense probably null
R6753:Dcbld2 UTSW 16 58456130 missense possibly damaging 0.94
R7213:Dcbld2 UTSW 16 58450763 missense probably benign 0.02
R7360:Dcbld2 UTSW 16 58465320 splice site probably null
R7555:Dcbld2 UTSW 16 58448718 splice site probably null
R7570:Dcbld2 UTSW 16 58424569 missense possibly damaging 0.86
R7593:Dcbld2 UTSW 16 58424578 missense possibly damaging 0.82
R8072:Dcbld2 UTSW 16 58463097 nonsense probably null
R8175:Dcbld2 UTSW 16 58433347 missense possibly damaging 0.63
R8193:Dcbld2 UTSW 16 58464010 splice site probably null
R8323:Dcbld2 UTSW 16 58463110 critical splice donor site probably null
R8804:Dcbld2 UTSW 16 58461049 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- CTTTGGTTACTACTGTGAGAGAGCC -3'
(R):5'- CTGACATGTCCATGACGATCG -3'

Sequencing Primer
(F):5'- TTACTACTGTGAGAGAGCCTAAACG -3'
(R):5'- ACGATCGGGGTTGCGTACTC -3'
Posted On2015-04-17