Incidental Mutation 'R3931:Lipo4'
ID308484
Institutional Source Beutler Lab
Gene Symbol Lipo4
Ensembl Gene ENSMUSG00000079344
Gene Namelipase, member O4
SynonymsGm6857
MMRRC Submission 040918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R3931 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location33498037-33517780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33503219 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 250 (V250I)
Ref Sequence ENSEMBL: ENSMUSP00000108130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112511]
Predicted Effect probably benign
Transcript: ENSMUST00000112511
AA Change: V250I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108130
Gene: ENSMUSG00000079344
AA Change: V250I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Abhydro_lipase 35 97 3e-24 PFAM
Pfam:Hydrolase_4 74 239 4.7e-8 PFAM
Pfam:Abhydrolase_1 78 214 2.5e-16 PFAM
Pfam:Abhydrolase_5 78 372 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143522
SMART Domains Protein: ENSMUSP00000121321
Gene: ENSMUSG00000079344

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 37 99 1.3e-24 PFAM
Pfam:Hydrolase_4 76 241 7.1e-9 PFAM
Pfam:Abhydrolase_1 80 214 8.8e-17 PFAM
Pfam:Abhydrolase_5 80 235 1.5e-8 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik A C 6: 92,834,439 probably benign Het
Cbarp A G 10: 80,135,514 L159P probably damaging Het
Ccnd2 A G 6: 127,130,459 I249T probably damaging Het
Cerk G T 15: 86,155,110 C193* probably null Het
Chrna2 A G 14: 66,149,767 E454G probably benign Het
Clnk T C 5: 38,768,069 T130A probably benign Het
Dcbld2 T C 16: 58,465,338 L620P probably damaging Het
Dhx29 T A 13: 112,958,965 V942E probably damaging Het
Dnah17 C T 11: 118,080,849 probably benign Het
Dnaic1 G A 4: 41,604,229 C212Y probably damaging Het
Dpep1 A G 8: 123,198,779 D57G possibly damaging Het
Gfm2 G A 13: 97,175,024 V701I probably benign Het
Grm1 C T 10: 10,719,878 A669T probably benign Het
Hsd3b3 C T 3: 98,742,176 G277D probably damaging Het
Hsf5 A G 11: 87,631,682 Y367C probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc14 T C 15: 76,713,565 V165A probably benign Het
Map3k9 A G 12: 81,772,917 F188L probably damaging Het
Mpo A G 11: 87,801,040 Y433C probably damaging Het
Nsd2 A G 5: 33,846,117 K185E probably benign Het
Olfr430 T A 1: 174,069,581 F94L probably damaging Het
Oxct1 T A 15: 4,037,119 N72K possibly damaging Het
Ptpn12 A G 5: 21,001,323 I324T probably benign Het
Sez6 T C 11: 77,976,882 I875T probably damaging Het
Tpr T A 1: 150,435,904 V1811E probably damaging Het
Trpc4 A G 3: 54,318,095 D871G probably damaging Het
Upf2 A G 2: 6,047,010 E1161G unknown Het
Zp2 T C 7: 120,132,357 probably benign Het
Other mutations in Lipo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Lipo4 APN 19 33515686 missense probably damaging 1.00
IGL01609:Lipo4 APN 19 33499254 missense probably benign 0.01
IGL01731:Lipo4 APN 19 33512613 missense probably damaging 1.00
R0134:Lipo4 UTSW 19 33501606 missense probably benign 0.02
R0225:Lipo4 UTSW 19 33501606 missense probably benign 0.02
R1155:Lipo4 UTSW 19 33503195 missense probably benign
R1381:Lipo4 UTSW 19 33499341 missense probably benign 0.02
R1460:Lipo4 UTSW 19 33499318 missense probably benign
R1607:Lipo4 UTSW 19 33512673 missense probably damaging 1.00
R1777:Lipo4 UTSW 19 33499321 missense probably damaging 1.00
R1919:Lipo4 UTSW 19 33499271 missense possibly damaging 0.66
R1998:Lipo4 UTSW 19 33514301 missense probably damaging 0.98
R2088:Lipo4 UTSW 19 33500069 missense possibly damaging 0.95
R2112:Lipo4 UTSW 19 33511526 missense probably benign 0.07
R4588:Lipo4 UTSW 19 33499247 missense possibly damaging 0.82
R4869:Lipo4 UTSW 19 33501553 critical splice donor site probably null
R5406:Lipo4 UTSW 19 33503218 missense probably benign 0.00
R5640:Lipo4 UTSW 19 33501586 missense possibly damaging 0.92
R6160:Lipo4 UTSW 19 33503293 missense probably damaging 0.99
R6957:Lipo4 UTSW 19 33499367 missense probably benign 0.30
R7403:Lipo4 UTSW 19 33503279 missense possibly damaging 0.91
R7816:Lipo4 UTSW 19 33514242 missense probably damaging 1.00
R7847:Lipo4 UTSW 19 33514199 missense possibly damaging 0.95
R7868:Lipo4 UTSW 19 33511568 missense possibly damaging 0.68
R7890:Lipo4 UTSW 19 33501564 missense probably damaging 1.00
R7930:Lipo4 UTSW 19 33514199 missense possibly damaging 0.95
R7951:Lipo4 UTSW 19 33511568 missense possibly damaging 0.68
R7973:Lipo4 UTSW 19 33501564 missense probably damaging 1.00
X0028:Lipo4 UTSW 19 33503288 frame shift probably null
Z1176:Lipo4 UTSW 19 33503184 missense not run
Predicted Primers PCR Primer
(F):5'- AATTGCATGCAGGACACACC -3'
(R):5'- CAGCAGCACATAGTAGTTTTGTC -3'

Sequencing Primer
(F):5'- AGTTAGCAGATACAGTTGCTCTC -3'
(R):5'- CAGCACATAGTAGTTTTGTCTTTTG -3'
Posted On2015-04-17